Question

In: Biology

Below are the DNA sequences that encode the first eight amino acids for four alleles of...

Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter.

ATGTCTCTCACCAACAAGAACGTC

ATGgCTCTCACCAACAAGAACGTC

ATGTCgCTCACCAACAAGAACGTC

ATGTCTtTgACCAACAAGAACGTC

a. What are the first eight amino acids for each of these four DNA sequences?

b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism.

c. Synonymous polymorphisms tend to be more common than nonsynonymous ones. Why might that be?

Solutions

Expert Solution

The 4 sequences are:
ATGTCTCTCACCAACAAGAACGTC
ATGgCTCTCACCAACAAGAACGTC
ATGTCgCTCACCAACAAGAACGTC
ATGTCTtTgACCAACAAGAACGTC

Answer a. The first 8 amino acids given by each of them are:
Using the codon table for conversion of 3-letter genetic codon into amino acid, we get
MetSerLeuThrAsnLysAsnVal
MetAlaLeuThrAsnLysAsnVal
MetSerLeuThrAsnLysAsnVal
MetSerLeuThrAsnLysAsnVal

Answer b.
Polymorphism is an altered nucleotide. Synonymous is when the same amino acid is produced irrespective of the alteration. Non-synonymous is when the amino acid produced is different.

MetSerLeuThrAsnLysAsnVal
MetAlaLeuThrAsnLysAsnVal - Non-synonymous polymorphism
MetSerLeuThrAsnLysAsnVal - Synonymous polymorphism
MetSerLeuThrAsnLysAsnVal - Synonymous polymorphism

Answer c.
Most of the 3-letter codes across the codon table are pretty repetitive for the amino acid that they encode. These polymorphisms generally occur in the third element in the codon, and it happens to be that most amino acids are formed with major emphasis on the first 2 elements of the codon as the third and last element can be any nucleotide but the same amino acid will be formed any way.


Related Solutions

Below are the DNA sequences that encode the first eight amino acids for four alleles of...
Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC a. What are the first eight amino acids for each of these four DNA sequences? b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c. Synonymous polymorphisms tend to be more common...
Below are the DNA sequences that encode the first eight amino acids for five alleles of...
Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh protein in Drosphila pseudoobscura. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC ATGTCTCTCACCAACAAGAACGTg a. What are the first eight amino acids for each of these five DNA sequences? b. For each of the five polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c. The fourth sequence shown above has...
Interrupted coding sequences include long sequences of bases that do NOT code for amino acids. These...
Interrupted coding sequences include long sequences of bases that do NOT code for amino acids. These noncoding sequences, called ________, are found in ________ cells. exons; prokaryotic introns; prokaryotic exons; eukaryotic introns; eukaryotic none of these are correct Which of the following is TRUE about cytoplasmic inheritance? It refers to chromosomal genes. It is independent of the gender of the parent. It follows Mendel’s law of segregation. It originates from plasmids in the cytoplasm. It is based on the widely...
11.Which of the following sequences of amino acids is the most likely to be located on...
11.Which of the following sequences of amino acids is the most likely to be located on the exterior of a water soluble globular protein? a. Arg-Ser-Gln-Pro-His b. Met-Phe-Ile-Leu-Ala c. Val-Leu-Ser-Ala-Val d. Met-Val-Cys-Leu-Gln QUESTION 12 1.     Which pair of amino acid side chains might form a London dispersion force type of van der Waals interaction in a globular protein? a. His and Ser b. Ala and Gln c. His and Met d. Val and Met QUESTION 13 1.     The β-hairpin consists...
Researchers have described the “binary patterning” of polar and nonpolar amino acids in the sequences of...
Researchers have described the “binary patterning” of polar and nonpolar amino acids in the sequences of proteins. In their code, polar and charged residues like D, N, E, Q, K, H, and R are represented as open circles (○) and nonpolar residues like F, L, I, M, and V as closed circles (●). Thus, a polypeptide with the sequence asp-ile-his-phe-gln would be represented as ○●○●○. Researchers analyzed the binary patterns of isolated secondary structure elements (short pieces) from native proteins....
A gene is composed of DNA and a protein is composed amino acids. Describe the steps...
A gene is composed of DNA and a protein is composed amino acids. Describe the steps involved in converting the information contained in a gene into a protein. **Please include and define all of the following terms in your description:** Ribosome, template strand, non-template strand, reading frame, complementary, tRNA, mRNA, start codon, stop codon, transcription factors, 5’ to 3’, translation, transcription, gene promoter, RNA polymerase
Explain the relationship between DNA, genes , proteins and amino acids in 100-300 words
Explain the relationship between DNA, genes , proteins and amino acids in 100-300 words
DNA Polymerase can distinguish between dNTPs and rNTPs because of discriminator amino acids in the enzyme's...
DNA Polymerase can distinguish between dNTPs and rNTPs because of discriminator amino acids in the enzyme's nucleotide-binding pocket. These amino acids occupy the space where the 2'OH group of an incoming rNTP would need to reside in order to properly position the substrates for catalysis. These discriminator amino acids usually have large R groups, which sterically exclude the ribose 2'OH. If you experimentally mutate/change the discriminator amino acids to glycines, predict the effect that this change might have on DNA...
Complete the genetic information (DNA base pairs, t-RNA and mRNA nucleotide bases, and the amino acids...
Complete the genetic information (DNA base pairs, t-RNA and mRNA nucleotide bases, and the amino acids this gene codes for, in the following DNA strand1 :    ATG     _____    _____   _____    _____     _____    CGC DNA strand 2 : *_____    GCC    _____   _____    _____    AGT     _____    mRNA : _____   _____    AUA    _____    UUU   _____    _____    tRNA : _____    _____   _____     UAC     _____   _____    _____ Amino acids :   ______   ______   _____   _____   ______   ______   ______ (Remember which type of RNA actually...
DNA strand mRNA tRNA from Figure 2 Amino Acids (number and name) from Figure 3 pg...
DNA strand mRNA tRNA from Figure 2 Amino Acids (number and name) from Figure 3 pg 80 C C T G G A C C U 4 Glycine G A A G G T A C G T T A G T T G A C A T G A C G
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT