Which 3 terms correctly describe the kind of bacteria most likely to form pink colonies in...

Which 3 terms correctly describe the kind of bacteria most likely to form pink colonies in toilets and bathtubs?

		Alphaproteobacteria
		Rhizobiales
		Methylobacterium sp.
		Betaproteobacteria
		Serratia marcescens
		Chromobacterium violaceum
		Gammaproteobacteria

The causative agents of Typhus and Rocky Mountain Fever are members of which group of bacteria listed below?

There are 2 correct answers.

		Rickettsiales
		Gammaproteobacteria
		Alphaproteobacteria
		Pseudomonadales
		Betaproteobacteria
		Neisseriales
		Burkholderiales

Rhizobiales, a nitrogen-fixing group of bacteria, are part of which sub group of proteobacteria?

		Betaproteobacteria
		Deltaproteobacteria
		Epsilonproteobacteria
		Gammaproteobacteria
		Alphaproteobacteria

Expert Solution

1. The correct answer is Methylobacterium sp, Serrata marcescens, Gammaproteobacteria

Methylobacterium sp, Serrata marcescens, Gammaproteobacteria are the 3 kinds of bacteria that form a pink or red slime-like mold in toilets and bathtubs. These tend to grow in moist places and bathtubs and toilets are favorable habitats for them to grow. First, they appear as small spots, and eventually, they spread or grow in other fertile places. Basically, Serrata marcescens belong to the proteobacterium class of Gammaproteobacteria.

2. The correct answer is Rickettsiales and Alphaproteobacteria

The causative agents for Typhus and Rocky mountain fever are Rickettsiales species. These are transmitted by ticks, mice and other insects. They are gram-negative, nonmotile, and cocci in shape. The causative agent for typhus is Rickettsia typhi. This group of bacteria belongs to the class of alphaproteobacteria. These comprise of intracellular pathogens like rickettsia, symbionts of plants like rhizobium, and other several genera.

3. The correct answer is Alphaproteobacteria

Rhizobiales which are nitrogen-fixing bacteria basically belong to a class of alphaproteobacteria. These are gram-negative in nature and they live either as free-living soil bacteria or by their interaction with roots of leguminous plants.

gladiator answered 1 year ago

Which pair of elements is most likely to form an ionic bond? 1, Which pair of...

Which pair of elements is most likely to form an ionic bond? 1, Which pair of elements is most likely to form an ionic bond A, silicon and oxygen B, nitrogen and chlorine C, barium and oxygen D, sulfur and chlorine Which pair of elements is most likely to form an ionic bond? 2, Which pair of elements is most likely to form an ionic bond? A, sulfur and fluorine B, calcium and chlorine C, phosphorus and oxygen D, silicon...

What kind of interaction can threonine and asparagine form? Would this interaction be likely to form...

What kind of interaction can threonine and asparagine form? Would this interaction be likely to form on the surface of a protein? Why or why not? What role does this interaction play in protein stability?

Question 1 Which kind of conflict is most likely to result in better team outcomes like...

Question 1 Which kind of conflict is most likely to result in better team outcomes like increased energy and creativity, rather than negative feelings and poor team performance? (pick one) a) A high amount of process conflict where it is hard for the team to figure out how to delegate b) A moderate amount of relationship conflict where everyone somewhat dislikes each other c) A low level of overall conflict, where people avoid discussing problems d) Moderate conflict focused on...

Which diagram below correctly illustrates the fusion of normal gametes that will most likely produce a human female?

Which diagram below correctly illustrates the fusion of normal gametes that will most likely produce a human female? Explain.

Which of the firms below is likely to receive the most favorable terms when borrowing money...

Which of the firms below is likely to receive the most favorable terms when borrowing money from the bond market? Firm A: cash coverage ratio = 0.6 and debt-to-equity ratio = 1.2 Firm B: cash coverage ratio = 0.8 and debt-to-equity ratio = 1.5 Firm C: cash coverage ratio = 1.5 and debt-to-equity ratio = 0.6 Firm D: cash coverage ratio = 1.2 and debt-to-equity ratio = 0.8

The change in the protein from the Awake form to the recessive narcolepsy form most likely...

The change in the protein from the Awake form to the recessive narcolepsy form most likely arose in ancestral Labs __________. A. as a result of a random DNA mutation in Lab gametes (eggs or sperm) B. as a result of Lab breeders choosing to breed only dogs that preferred sleeping to retrieving C. because Labs were tired and wanted to sleep more D. as a result of damage to Labs in fights with water snakes E. as a result...

1. A researcher wants to know what kind of exercising is most likely to lead to...

1. A researcher wants to know what kind of exercising is most likely to lead to improve people’s moods. He has participants engage in one month of regular workouts (cardio, weight training, or yoga) and then has them complete a mood measure (1-10, higher scores = better mood). Is there a significant difference in groups? Hand calculate the ANOVA using a significance level of .05 and then check your work using SPSS. Cardio Weights Yoga 8 9 7 7 5...

Describe the various ways to close adeal. Which one is most likely to be used...

Describe the various ways to close a deal. Which one is most likely to be used by a seller of a house with a buyer who has made it clear that he or she is shopping around for other houses? Give a specific example of how the strategy might be used by the seller of the house to entice the buyer to make the purchase.

Identify/highlight all possible palindromic sequences. Which one of these two examples is most likely to form...

Identify/highlight all possible palindromic sequences. Which one of these two examples is most likely to form a hair loop - highlight the hair loop sequence? Example 1: 5' - GCAACTGGATAGCCCTAGAAGGACTAGGGCTTTTCCAAGTCAA - 3' Example 2: 5' - TATTTGCATTCCCTGCAGGGAATCGTTAAGGAGGGCAGTCTTAA - 3'

State which form you would most likely choose for your own business based on the level...

State which form you would most likely choose for your own business based on the level of risk aversion, experience, financial situation and tax considerations. Explain your decision.

Question