Which diagram below correctly illustrates the fusion of normal gametes that will most likely produce a human female?

Which diagram below correctly illustrates the fusion of normal gametes that will most likely produce a human female? Explain.

Expert Solution

Answer: ‘1’ where the sperm (with the flagellum) having X chromosome is going to get united with the egg containing X chromosome.

Explanation: In humans the sex determination is based on one pair of chromosomes, if the pair is XY+ 22 pairs of autosomes it is male and if the pair is XX + 22 pairs of autosomes it is the female.

In short, the sex determination in humans is XX/XY type.

For a child to be born there has to be a fertilization of a male gamate with a female gamate

The sperm is the male gamate, which is motile and for motility it possesses flagellum, since the males are having XY chromosome pair, they are heterogametic, in one gamate the male will have the X chromosome + 22 autosomes and another gamate there will be Y chromosome + 22 autosomes.

While the human female is homogamatic i.e there will be same types of gamates produced by the female containing one X chromosome +22 autosomes.

If the sperm containing Y chromosome fertilizes the egg containing X chromosome, a male child will be born

If the sperm containing X chromosome fertilizes the egg containing X chromosome, a female child will be born as it is shown in option ‘1’ in the image, hence ‘1’ is the answer.

gladiator answered 2 years ago

Which diagram CORRECTLY illustrates the clustering of lipids in the formation of a micelle?

Which diagram CORRECTLY illustrates the clustering of lipids in the formation of a micelle? Select one: a. neither A nor B b. both A and B с. А d. B

Which of the following correctly illustrates the conservation of mass for the reaction below? 4Fe(s) +...

Which of the following correctly illustrates the conservation of mass for the reaction below? 4Fe(s) + 3O2(g) → 2Fe2O3(s) Which of the following correctly illustrates the conservation of mass for the reaction below? 4Fe(s) + 3O2(g) → 2Fe2O3(s) 223 g Fe, 96.0 g O2, 319 g Fe2O3 4.00 g Fe, 3.00 g O2, 2.00 g Fe2O3 40.0 g Fe, 30.00 g O2, 70.0 g Fe2O3 55.9 g Fe, 16.0 g O2, 160. g Fe2O3 100. g Fe, 100. g O2,...

2.. The diagram below illustrates the human DNA nucleotide sequence containing the somatostatin gene. (2) •...

2.. The diagram below illustrates the human DNA nucleotide sequence containing the somatostatin gene. (2) • Highlight in red the bases between which EcoRI cuts on each strand of the DNA sequence. • Highlight in turquoise the bases between which BamHI cuts each strand of the DNA sequence. 5’ 3’ GAATTCATGGCTGGTTGTAAGAACTTCTTTTGGAAGACTTTCACTTCGTGTTAGTAGGATCC 3’ 5’ CTTAAGTACCGACCAACATTCTTGAAGAAAACCTTCTGAAAGTGAAGCACAATCATCCTAGG

For each of the following statements, draw a diagram that illustrates the likely effect on the...

For each of the following statements, draw a diagram that illustrates the likely effect on the market for Toyota cars. Indicate in each case the impact on equilibrium price and equilibrium quantity.. A Mechanic Engineer warns that new Toyota cars overheats during long journeys. b. The price of rubber which is used to produce tyres reduces. c. A fall in the price of Nissan cars. d. A rise in bus tariffs . e. A successful advertising of...

Which diagram illustrates multiple inheritance?

Which diagram illustrates parallel lines?

Which of these figures correctly illustrates the nature of the bonding of H2O?

Part AWhich of these figures correctly illustrates the nature of the bonding of H2O?Part BWhat type of bond joins the carbon atom to each of the hydrogen atoms?What type of bond joins the carbon atom to each of the hydrogen atoms?double (nonpolar) covalentsingle (nonpolar) covalentpolar covalentionichydrogen

Of the human traits listed below, which are likely to be under the control of a...

Of the human traits listed below, which are likely to be under the control of a polygenic mode of inheritance? (Chose all that apply.) a. color blindness b. ABO blood type c. skin color d. intelligence e. height f. sickle cell anemia

Which of the following is most likely to produce a specific acid that allows the pathogen...

Which of the following is most likely to produce a specific acid that allows the pathogen to invade subepithelial tissues? Gamma hemolytic, catalase positive, gram positive cocci Catalase positive, coagulase positive, gram negative cocci Gamma hemolytic, catalase negative, gram negative cocci Beta hemolytic, catalase negative, gram positive cocci

d. Draw a diagram that illustrates how nuclei change during nuclear fusion. Write 2 - 3...

d. Draw a diagram that illustrates how nuclei change during nuclear fusion. Write 2 - 3 sentences describing the process of nuclear fusion, including where it occurs and how the energy released can be harnessed for use in homes. (8 points)

Question