Question

In: Biology

Identify/highlight all possible palindromic sequences. Which one of these two examples is most likely to form...

Identify/highlight all possible palindromic sequences. Which one of these two examples is most likely to form a hair loop - highlight the hair loop sequence?

Example 1: 5' - GCAACTGGATAGCCCTAGAAGGACTAGGGCTTTTCCAAGTCAA - 3'

Example 2: 5' - TATTTGCATTCCCTGCAGGGAATCGTTAAGGAGGGCAGTCTTAA - 3'

Solutions

Expert Solution

ANSWER- Palindromic sequences are those sequence which read the same in both forward (5'-3') and backward(3'-5') directions.

Example 1: 5' -GCAACTGGATAGCCCTAGAAGGACTAGGGCTTTTCCAAGTCAA-3'

3' -AGTTGACCTATCGGGATCTTCCTGATCCCGAAAAGGTTCAGTT-5'

In the above example, the reverse complement of the DNA sequence does read the same in the backward direction. Hence, there is no palindrome sequence.

Example 2. 5'-TATTTGCATTCCCTGCAGGGAATCGTTAAGGAGGGCAGTCTTAA-3'

3'- ATAAACGTAAGGGACGTCCCTTAGCAATTCCTCCCGTCAGAATT-5'

In the above example, the reverse complement of the DNA sequence does read the same in the backward direction. Hence, there is no palindrome sequence.

Answer 2. Example1. DNA sequence will form a hair loop structure.

Hairloop structure is formed two regions within the same sequence strand are complementary to each other when reading in opposite direction with an unpaired loop of sequence between them.

5' - GCAACTGGATAGCCCTAGAAGGACTAGGGCTTTTCCAAGTCAA - 3'

The region shaded in yellow - Complementary sequence

The region shaded in orange- Unpaired loop structure

  


Related Solutions

11.Which of the following sequences of amino acids is the most likely to be located on...
11.Which of the following sequences of amino acids is the most likely to be located on the exterior of a water soluble globular protein? a. Arg-Ser-Gln-Pro-His b. Met-Phe-Ile-Leu-Ala c. Val-Leu-Ser-Ala-Val d. Met-Val-Cys-Leu-Gln QUESTION 12 1.     Which pair of amino acid side chains might form a London dispersion force type of van der Waals interaction in a globular protein? a. His and Ser b. Ala and Gln c. His and Met d. Val and Met QUESTION 13 1.     The β-hairpin consists...
Which of the following approaches is most likely to identify a gene?
Which of the following approaches is most likely to identify a gene?Identifying sequences that are not different between two species.Identifying regions of that genome that are not transcribed.Identifying sequences that can be deleted without any phenotypic effect.Identifying sequences that do not have open reading frames.   
1. Restriction enzymes (select all that apply): Always produce sticky ends. Typically cleave at palindromic sequences...
1. Restriction enzymes (select all that apply): Always produce sticky ends. Typically cleave at palindromic sequences 4-8bp long. Cleave invading viral DNAs. Are found in a wide variety of mammalian cell types. Are necessary for joining two DNA fragments together. 2. A polylinker is: A synthetic fragment that contains multiple sites for restriction enzymes to cut the DNA. A synthetic fragment inserted into a vector that allows replication of the vector in the host cell. An enzyme used to connect...
Which pair of elements is most likely to form an ionic bond? 1, Which pair of...
Which pair of elements is most likely to form an ionic bond? 1, Which pair of elements is most likely to form an ionic bond A, silicon and oxygen B, nitrogen and chlorine C, barium and oxygen D, sulfur and chlorine Which pair of elements is most likely to form an ionic bond? 2, Which pair of elements is most likely to form an ionic bond? A, sulfur and fluorine B, calcium and chlorine C, phosphorus and oxygen D, silicon...
Which types of companies would most likely use a process costing system? Provide examples of two...
Which types of companies would most likely use a process costing system? Provide examples of two Compagnies. Explain the methods with which the cost per unit will be calculated for this type of companies. Explain how the different items of inventory will be evaluated?
The change in the protein from the Awake form to the recessive narcolepsy form most likely...
The change in the protein from the Awake form to the recessive narcolepsy form most likely arose in ancestral Labs __________. A. as a result of a random DNA mutation in Lab gametes (eggs or sperm) B. as a result of Lab breeders choosing to breed only dogs that preferred sleeping to retrieving C. because Labs were tired and wanted to sleep more D. as a result of damage to Labs in fights with water snakes E. as a result...
Thinking of the Middle East, identify at least one item that is most likely produced using...
Thinking of the Middle East, identify at least one item that is most likely produced using job order costing ( i have choosen refined petroleum with pre defined attributes), and one item that is most likely produced using process costing (crude oil). Explain why you think each one would be produced under the system identified.
Which one of the following items is most likely to be reported as goodwill? A. Skilled...
Which one of the following items is most likely to be reported as goodwill? A. Skilled workforce B. In-process research and development C. Brand names D. Developed technology
Which 3 terms correctly describe the kind of bacteria most likely to form pink colonies in...
Which 3 terms correctly describe the kind of bacteria most likely to form pink colonies in toilets and bathtubs? Alphaproteobacteria Rhizobiales Methylobacterium sp. Betaproteobacteria Serratia marcescens Chromobacterium violaceum Gammaproteobacteria The causative agents of Typhus and Rocky Mountain Fever are members of which group of bacteria listed below? There are 2 correct answers. Rickettsiales Gammaproteobacteria Alphaproteobacteria Pseudomonadales Betaproteobacteria Neisseriales Burkholderiales Rhizobiales, a nitrogen-fixing group of bacteria, are part of which sub group of proteobacteria? Betaproteobacteria Deltaproteobacteria Epsilonproteobacteria Gammaproteobacteria Alphaproteobacteria
Identify two examples of the most commonly required disclosure on accounting policies. How are those examples...
Identify two examples of the most commonly required disclosure on accounting policies. How are those examples useful to financial statement users? Analyze Verizon Communications’ disclosure on accounting policies, and give your opinion on whether or not the information is helpful for decision making.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT