Question

In: Biology

Question 1: You set up a 200 µL PCR to amplify a 1-kb fragment by adding...

Question 1: You set up a 200 µL PCR to amplify a 1-kb fragment by adding 20 µL of a 500 nM primer that is 20-bp in length. How many times would you expect to find the exact 20-bp sequence in the human genome (using a genome size of 3.0 E+9 bp) at random? How many moles of the primer have you added? How many molecules of that primer have you added? Describe whether this amount of primer is a limiting factor in the success of the PCR in relation to the number of copies generated before a PCR normally plateaus (4 marks; show unit conversions and calculations for full marks).

Solutions

Expert Solution

gladiator answered 1 year ago
Next > < Previous

Related Solutions

7.You want to set up a PCR reaction. The protocol suggests a 50 µL reaction volume...
7.You want to set up a PCR reaction. The protocol suggests a 50 µL reaction volume containing 1X buffer, 200 µM dNTPs, 0.5 µM each primer (forward and reverse), 250 ng template DNA, and 1 U enzyme. You have the following reagents: 5 X buffer, 10 mM dNTPs, 10 µM each primer (forward and reverse), 125 ng/µL template DNA, and 2 U/µL enzyme. How many µL of water, reaction buffer, dNTPs, each primer, template DNA and enzyme would you combine...
6.- Your friend Silvester wishes to subclone a 1.7 kb DNA fragment into the pCR 2.1...
6.- Your friend Silvester wishes to subclone a 1.7 kb DNA fragment into the pCR 2.1 TOPO plasmid vector. His goal is to amplify the desired fragment by PCR. At the end of the PCR cycling reaction, he immediately adds 4 ?L of PCR reaction, (the maximum of DNA allowable) to the ligation mix. He did the transformation and plated it onto solid media containing the right amount of X-gal and ampicillin. He picked a single white colony, inoculated it...
You now set up a ligation reaction with the following components: • Plasmid Vector (0.05 µg/µL)...
You now set up a ligation reaction with the following components: • Plasmid Vector (0.05 µg/µL) • Insert DNA (0.2 µg/µL) • 10X Ligase Buffer • Water Because you are unsure what the best ratio of insert to plasmid is, as this is a new experiment for you, you plan to set up two experiments, one with a 3:1 ratio of insert to plasmid, and one with a 6:1 ratio of insert to plasmid. In both cases the amount of...
1. ⦁   Your supervisor has asked you to desine PCR primers to amplify the following region...
1. ⦁   Your supervisor has asked you to desine PCR primers to amplify the following region in the human genome. 5’- CGTTCGTAATCTTGGTGAATTAATCCGATGTAGTGAAGA GGCGGCCACTGAGCAACAGTGATTGTGTGCTGCTGTGTC TCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCC TGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTG AACCACTGAACCACAGCTACCAAGCCATCATCATGCTAT GGATGCTTGCATTACCAAGGCAAGCT -3’ Here is the sequence for the forward/right primer. 5’- CGTTCGTAATCTTGGTGAATTAAT-3’ a) Was this primer designed to bind the DNA strand given above or the complementary strand? Hint: you may want to write out the complementary sequence to this DNA sequence to help you answer this question. b) Underline the bases where this...
You want to use PCR to amplify a 1Kb exon of the human autosomal gene phenylalanine...
You want to use PCR to amplify a 1Kb exon of the human autosomal gene phenylalanine hydroxylase (PH) from the genome of a person suffering from the disease phenylketonuria, which is due to this enzyme not functioning. a) You start with 1 nanogram of genomic DNA in your sample tube. Assuming a human haploid genome is 3 x 109 bp, and each bp has a mass of 660 g/mole, how many moles of haploid genomes are present at the start...
You want to use PCR to amplify a 1Kb exon of the human autosomal gene phenylalanine...
You want to use PCR to amplify a 1Kb exon of the human autosomal gene phenylalanine hydroxylase (PH) from the genome of a person suffering from the disease phenylketonuria, which is due to this enzyme not functioning. a) You start with 1 nanogram of genomic DNA in your sample tube. Assuming a human haploid genome is 3 x 109 bp, and each bp has a mass of 660 g/mole, how many moles of haploid genomes are present at the start...
If you would do a PCR experiment using the Klenow fragment of the E.coli DNA polymerase...
If you would do a PCR experiment using the Klenow fragment of the E.coli DNA polymerase I instead of Taq DNA polymerase, what would you have to change in the experimental set-up and explain why?
​​​​​​​Describe how you can use PCR to obtain a gene fragment X that can be cloned...
​​​​​​​Describe how you can use PCR to obtain a gene fragment X that can be cloned into a plasmid vector for expression of the recombinant protein. Include in your description how the PCR reaction will be performed, how the amplicon will be analyzed, the use of restriction enzymes, how cloning will be achieved, how you will know that you have a recombinant containing the insert gene fragment X and how you will detect the recombinant protein.
Describe how you can use PCR to obtain a gene fragment X that can be cloned...
Describe how you can use PCR to obtain a gene fragment X that can be cloned into a plasmid vector for expression of the recombinant protein. Include in your description how the PCR reaction will be performed, how the amplicon will be analyzed, the use of restriction enzymes, how cloning will be achieved, how you will know that you have a recombinant containing the insert gene fragment X and how you will detect the recombinant protein.
In the PCR exercise you described why we amplify the 16s ribosomal RNA gene.  What other genes...
In the PCR exercise you described why we amplify the 16s ribosomal RNA gene.  What other genes might help us to identify specific bacteria?  In other words, what traits could be sequenced that are unique to bacteria?
ADVERTISEMENT
Subjects
ADVERTISEMENT
Latest Questions
ADVERTISEMENT