Why would the adaptive immune system be more effective than the innate system to fight off Pertussis?

How memebers of Dyslexia suffer because of the wrongful assumptions made about them? Please focus on peer persecution and discrimination at learning institutions.

Would a reference laboratory get involved with a transfusion reaction work up?

If a person has alloantibody that cannot be identify, would it be sent it out? If so, what techniques would the reference laboratory use to identify it?

What happens to chlorophyll a from the light harvesting complex after absorbing light? What happens to chlorophyll a from the reaction center after absorbing light?

Chapter 9: CENTRAL NERVOUS SYSTEM

a) What are gray and white matter composed of in the CNS?

b) What are clusters of cell bodies called if they are located in the CNS? How about the PNS? What are bundles of axons called in the CNS? How about the PNS?

c) What are the three meninges? Describe their functions and relative locations.

d) What two fluids make up the extracellular environment in the brain?

e) Describe where cerebrospinal fluid is produced, where it flows and where it is reabsorbed.

f) Describe what the blood-brain barrier is. How can it select what passes and what does not? What freely passes across the blood-brain barrier? How does the blood-brain barrier affect clinical treatment of brain diseases?

g) Describe why diabetics who are hyperglycemic frequently suffer from hypoglycemic shock.

h) Describe the 6 main brain regions. Include their major functions and any structures housed within them.

i.) Describe the highly organized structure AND function of the cortex (why is the brain furrowed?)

j) What are the limbic system and reticular formation?

k) What are the four diffuse modulating systems (refer to book)? How are they named/characterized? What happens when there are deficiencies in communication within the system?

l) Describe the hypotheses for why we sleep. What are the benefits of REM vs deep (stage 4) cycles of sleep?

m) Describe Process S and C, and how the balance between them both drives sleep and wakefulness.

n) How is mood different than emotion?

o) What is one common cause for depression and give one example for how it can be clinically treated?

Discuss the burden of disease caused by communicable diseases and provide an example.

Discuss the criteria that are used to establish that an organism is a contributory cause of a disease

Discuss the factors that affect the transmissibility of a disease and provide an example

Discuss the roles that barrier protections play in preventing communicable diseases and provide an example

Discuss the roles that vaccinations can play in preventing communicable diseases and provide an example

Discuss the roles that screening, case finding, and contact treatment can play in preventing communicable diseases

Discuss the conditions that make eradication of a disease feasible

Discuss a range of options for controlling the HIV/AIDS epidemic and provide an example

Course - Public health

1. Explain how RNAi could be used to treat disease.

2. What are two specific ways in which RNAi can block the production of proteins.

3. RNAi exerts its effect by mainly controlling which process?

a. Termination

b. Translation

c. Transcription

d. Replication

e. Splicing

4. Which of the following is not true about miRNA?

a. One miRNA may match multiple targets

b. miRNA is used by scientist as a therapy

c. miRNA is found in plants and animals

d. miRNA is a product of a gene

5. An RNA molecule that loops to base pair with itself is called a.............. RNA because of its characteristic shape.

6. Suppose that you wish to target a gene using siRNA. The sense strand of the gene that is the DNA strand codes for the mRNA contains 21 base sequence: 5' TCGGAGCAAATAGGTAGGCA 3' What would be the most appropriate 21 base guide strand sequence that would target the mRNA?

5. A patient with chronic-stable angina begins taking metoprolol, and once blood levels reach the therapeutic range the frequency and severity of angina attacks and the need for sublingual nitroglycerin were reduced. Which of the following states the direct pharmacologic action by which the beta-blocker produced the desired effects? A. Decreased myocardial oxygen demand

B. Dilated coronary vasculature

C. Directly inhibited angiotensin II synthesis

D. Reduced total peripheral resistance

6. A patient with newly diagnosed essential hypertension starts treatment with a commonly used antihypertensive drug at a dose that is considered to be therapeutic for the vast majority of patients. Soon after starting therapy the patient experiences crushing chest discomfort. ECG changes show myocardial ischemia. Studies in the cardiac catheterization lab show episodes of coronary vasospasm, and it is likely the antihypertensive drug provoke the vasospasm. Which antihypertensive drug most likely caused the ischemia and the angina?

A. Atenolol

B. Diltiazem

C. Hydrochlorothiazide

D. Lozartan

7. A 28-year-old woman is receiving drug therapy for essential hypertension. She subsequently becomes pregnant. You realize that the drug she's been taking for her blood pressure can have serious, if not fatal, effects on the fetus. As a result, you stop the current antihypertensive drug and substitute it with another drug that is deemed to be equally effective in terms of her blood pressure, and safer for the fetus. Which of the following drugs was she most likely taking before she became pregnant?

A. Alpha-Methyldopa

B. Captopril

C. Furosemide

D. Labetalol E. Verapamil

8. The use of propranolol as an antiarrhythmic agent is contraindicated in patients with:

A. COPD

B. Asthma

C. Severe heart failure

D. A and C

E. All of the above

(biochem)

refering to the paper

"A safer poppy" by Jenny Rood. It was published in The Scientist, January 2018, vol. 31, 1, page 61. You can access this journal/magazine, for free, at the

www.the-scientist.com

What makes opioid drugs "double-edged" swords? Can the two sides of opioid drugs be separated? Why is the effort worth working on it?

In what directions research on receptors is going trying to solve the crisis? Are there several strategies?

Discuss strategies for finding safer alternatives to opioids: from target point of view and/or mechanism point of view.

Are there safer pain killer commercially available?

Give a nut-shell statement about the research in this field at the present.

1.

a) What are some unique (derived) characteristics of the Goblin Shark?

b) Does the Goblin Shark lose any characteristics that other similar animals have?

why is a tissue specific transcription factor important for tissue specific responses to inductive signals?

what is the role of a dna response element in inductive signaling?