Question

Question 4:

Point mutations Here you are given the template strand of a transcribed region of a very small gene. In the transcribed region is a protein coding region.

Describe how each of the following mutations (Mutants 1-3; see bolded nucleotides) will affect the final protein product. Name the type of mutation (silent, missense, nonsense, frameshift).

Briefly explain how you determined the type of mutation (it might help to transcribe and translate each mutant and compare to the original).

Original template strand: 3’ CGTTACCCGAGCCGTACGATTAGG 5’

Mutant 1: 3’ CGTTACCCGAGCCGTAACGATTAGG 5’ (insertion of an A nucleotide)

Mutant 2: 3’ CGTTACCCGATCCGTACGATTAGG 5’ (change from a G to T nucleotide)

Mutant 3: 3’ CGTTACCCGAGCCGTTCGATTAGG 5’ (change from an A to T nucleotide)

Answer 1

1.Mutant 1: ACG is converted to AAC. This insertion of extra A base leads to frame shift mutation wherein the frame of reading changes after the point of mutation.

Complementary sequence on mRNA : ACG- UGC - cysteine

AAC- UUG - Leucine. The final product changes from cysteine to leucine.

2.Mutant 2: AGC is converted to ATC

On mRNA, AGC codes for UCG and ATC codes for UAG.

UCG codes for serine. UAG is a stop codon. This is a non sense mutation. It is so because a single point mutation causes the codon to become a stop codon which means after the point of mutation, translation stops.

3.Mutant 3: ACG is converted to TCG

On mRNA, ACG codes for UGC and TCG codes for AGC.

UGC codes for cysteine. AGC codes for serine.

This is a missense mutation. It is so because a single nucleotide change results in a codon that codes for a totally different amino acid. Here, a single nucleotide change from A to T results in change of amino acid from cysteine to serine.

hope this helps:)

please do give it a thumbs up.

thank you!