The base sequence of a polynucleotide chain is given as follows. This is the template strand...

The base sequence of a polynucleotide chain is given as follows. This is the template strand of a DNA molecule. Please answer the questions following the base sequence.

3’-TAC GGG CTA CAA CTT AAC AGA CCA ATC-5’

What will be produced if this DNA molecule is replicated?
What are the anticodon sequences of the tRNA molecules that can carry these amino acids?
If this DNA got a mutation that changed the first 3 bases to 3'-ATT-5', what will happen to the polypeptide chain to be synthesized?

Expert Solution

Ansa) DNA replication results in two new DNA double helix in which each double helix consist of one parental strand and another new daughter strand. As DNA replication is semiconservative in human.

Ans-c) mutation in first three bases stop the translation process.

gladiator answered 2 years ago

Related to translation: Predict the amino acid sequence for the given template strand of DNA. ...

Related to translation: Predict the amino acid sequence for the given template strand of DNA. 3’- T A C G T T C A T A T C C G T A T G T A T A T T – 5’

1. Given the non-template strand of DNA, draw the template strand with the 5' and 3'...

1. Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends labeled. Draw the RNA molecule with the proper 5' and 3' ends labeled Non-Template Strand: 3'- AAT GCT CGT AGC TTC GAT CGG ATC GA-5' 2. How many amino acids would the RNA molecule code for?

Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends...

Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends labeled. Draw the RNA molecule with the proper 5' and 3' ends labeled Non-Template Strand: 3'- AAT GCT CGT AGC TTC GAT CGG ATC GA-5' My answers: Template= 5'- TAT CGA GCA TCG AAG CTA GCC TAG CT-3' RNA Molecule= 3'- AUA GCU CGU UGC UUC GAU CGG AUC GA-5' Next it asks, how many amino acids would the RNA molecule code for? -...

Explain the basis of complementary base paring. Given the nucleotide sequence of a single strand of...

Explain the basis of complementary base paring. Given the nucleotide sequence of a single strand of DNA (below), write the sequence of the complementary strand indicating the appropriate 5' and 3 " ends.

Consider a three-base sequence within the coding region in the DNA template strand: 5'-...123...-3', in which...

Consider a three-base sequence within the coding region in the DNA template strand: 5'-...123...-3', in which 1, 2, and 3 refer to the relative positions of deoxyribonucleotides within a codon. What would be the effects of a point mutation that would change a purine for a pyrimidine at position 2? 1. (True/False) This mutation will always result in an altered amino acid sequence in the mutant protein compared to the original protein. 2. (True/False) The mutant amino acid, if changed,...

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to...

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to an mRNA that was then translated to a protein. What would be the first amino acid in the polypeptide? Assume that no start codon is needed

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')

This sequence represents the non-template strand of the entire transcribed region (i.e., the first G is...

This sequence represents the non-template strand of the entire transcribed region (i.e., the first G is +1) of the ILTCD gene (which is the “I Love The Central Dogma” gene): 5’GAGATTCGATGGTAAGTCTCATTGCGTCCTGAGTCCTAATTTAAATAAAGCCTTTGTAATACAGGGCAATAAAGGCCTACGC 3’ What are the sequences of each of the three possible introns in this provided sequence. If the first hexanucleotide is used for 3’ end processing, how many exons will the final mRNA contain? If a regulatory protein sat down on the first hexanucleotide and blocked it, describe what...

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the...

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures?

Write the complimentary DNA sequence of the template strand below: 5’-TACGAATGCGCTATGTAAGCT3’ What is the complimentary RNA...

Write the complimentary DNA sequence of the template strand below: 5’-TACGAATGCGCTATGTAAGCT3’ What is the complimentary RNA sequence of the DNA strand above and what is the amino acid sequence? If you have an RNA transcript that is 100 bp, how many codons does it contain? If you take the template DNA that is shown in question 1 and you mutate the 6thnucleotide from A to G how does that impact the polypeptide sequence Is it better to have a mutation...

Question