6. The following sequences are mutations of the template sequence in question 1. For each mutated...

6. The following sequences are mutations of the template sequence in question 1. For each mutated sequence, indicate the new amino acid sequence produced and the type of mutation that is the end result in the amino acid (frameshift, Missense, nonsense, silent) as well as the type of mutation that occurred in the DNA sequence (substitution, addition, deletion)

Template sequence question 1: 3’ TACCCTGGTGGTTTGCGGACT 5’

a. 3’ TAC CCG GTG GTT TGC GGACT 5’

b. 3’ TAC ACT GGTGGTTTGCGGACT 5’

c. 3’ TAC CCTGGTGGTATGCGGACT 5’

Expert Solution

Ans-a) deletion of base in DNA sequence results in frame shift mutation in amino acid .

Ans-b) substitution of base in DNA sequence results in non sense mutation in amino acid.

Ans-c) substitution of base in DNA sequence results in miss sense mutation.

Solution shown in fig below:

If u r satisfied with this ans pls hit like button

gladiator answered 2 years ago

Question 1 - Infinite Sequences. (a). Determine an infinite sequence that satisfies the following . ....

Question 1 - Infinite Sequences. (a). Determine an infinite sequence that satisfies the following . . . (i) An infinite sequence that is bounded below, decreasing, and convergent (ii) An infinite sequence that is bounded above and divergent (iii) An infinite sequence that is monotonic and converges to 1 as n → ∞ (iv) An infinite sequence that is neither increasing nor decreasing and converges to 0 as n → ∞ (b). Given the recurrence relation an = an−1 +...

1. How does each of your mutations affect the amino acid sequences? Are the mutations missense...

1. How does each of your mutations affect the amino acid sequences? Are the mutations missense mutations, silent mutations or nonsense mutations? a. Point mutation? b. Frameshift-insertion? c. Frameshift-deletion? 2. What differences did you notice between the point mutation and the frameshift mutations? 3. Is it possible to determine the DNA sequence from the following amino acid sequence?: Leu Pro Arg. Why or Why not? References:

How does each of your mutations affect the amino acid sequences? Are the mutations missense mutations,...

How does each of your mutations affect the amino acid sequences? Are the mutations missense mutations, silent mutations or nonsense mutations? Point mutation? Frameshift-insertion? Frameshift-deletion The non mutated Sequence: AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG Point Mutation: AUG GAC GUC UUC AAG AGC CAU UUA GAA GUA GCC CUU AGU GAU GUC UAG Translation: Met Asp Val Phe Lys Ser His Leu Glu Val Ala Leu Ser Asp Val Stop....

For each of the following sequences find a functionansuch that the sequence is a1, a2, a3,...

For each of the following sequences find a functionansuch that the sequence is a1, a2, a3, . . .. You're looking for a closed form - in particular, your answer may NOT be a recurrence (it may not involveany otherai). Also, while in general it is acceptable to use a "by cases"/piecewise definition, for this task you must instead present a SINGLE function that works for all cases.(Hint: you may find it helpful to first look at the sequence of...

For each of the following degree sequences, determine if the exists a graph whose degree sequence...

For each of the following degree sequences, determine if the exists a graph whose degree sequence is the one specified. In each case, either draw a graph or explain why no such graph exists. a. (5,4,3,2,1) b. (5,4,3,3,2,1) c. (5,5,4,3,2,1) Please show work - Discrete Mathematics - THANKS

Find sequences that satisfy the following or explain why no such sequence exists: a) A sequence...

Find sequences that satisfy the following or explain why no such sequence exists: a) A sequence with subsequences converging to 1, 2, and 3. b) A sequence that is bounded above, but has no convergent subsequence. c) A sequence that has a convergent subsequence but is unbounded (note: unbounded means not bounded below or not bounded above. d) A sequence that is monotonic and bounded, but does not converge.

Regarding the trp operon leader sequence: 1.What would happen if the leader sequence was mutated in...

Regarding the trp operon leader sequence: 1.What would happen if the leader sequence was mutated in region 3, such that the it was missing? 2. Regarding Electrophoresis: Restriction endonuclease (why restricted?, why endo? Why -nucl-? Why - ase?) RFLP Ethidium Bromide Probe 3. DNA is ___________________ charged and therefore moves toward the _______________ electrode.

2. (6 pts) Speculate on the effects of each of the following mutations on the translation...

2. (6 pts) Speculate on the effects of each of the following mutations on the translation of the following mRNA. Specifically indicate whether any product would be made, and if so, if it would be altered in any way. (GpppG is the 5’ cap) 5’GpppGUAACAUGGUCGGACCAUGAC(A)2003’ Mutation that removes the editing pocket from isoleucine-tRNA synthetase. Mutation that prevents GTP hydrolysis of eEF1-a. Mutation that prevents binding of GTP by eEF2.

Question 4: Point mutations Here you are given the template strand of a transcribed region of...

Question 4: Point mutations Here you are given the template strand of a transcribed region of a very small gene. In the transcribed region is a protein coding region. Describe how each of the following mutations (Mutants 1-3; see bolded nucleotides) will affect the final protein product. Name the type of mutation (silent, missense, nonsense, frameshift). Briefly explain how you determined the type of mutation (it might help to transcribe and translate each mutant and compare to the original). Original...

Compare the following wild type and mutated mRNA sequences. Write out the amino acid polypeptide for...

Compare the following wild type and mutated mRNA sequences. Write out the amino acid polypeptide for both the wild type and mutated genes, note directionality of each fragment, and describe the type of mutation that is occurring and the consequences to the protein structure. Wild type mRNA: 3’- AUG CUU CAA GUU GGU CCU CCU UCG– 5’ Mutant mRNA: 3’- AUG CUU CAA GUU GGC CCU CCU UCG– 5’

Question