Question

In: Biology

Below is the sequence of part of the CYP1A2 gene (you are given only 1 strand,...

Below is the sequence of part of the CYP1A2 gene (you are given only 1 strand, written in the 5’ – 3’ direction).

TGGGCTAGGTGTAGGGGTCCTGAGTTCCGGGCTTTGCTACCCAGCTCTTGACTTCTGT

TTCCCGATTTTA AATGAGCAGTTTGGACTAAGCCATTTTTAAGGAGAGCGATGGGGAGG

GCTTCCCCCTTAGCACAAGGGCAGCCCTGGCCCTGGCTGAAGCCCAACCCCAACCTC

CAAGACTGTGAGAGGATGGGGACTCATCCCTGGAGGAGGTGCCCCTCCTGGTATTGAT

AAAGAATGCCCTGGGGAGGGGGCATCACAGGCTATTTGAACCAGCCCTGGGACCTTG

GCCACCTCAGTGTCACTGGGTAGGGGGAACTCCTGGTCCCTTGGGTATATGGAAGGTA

TCAGCAGAAAGCCAGCACTGGCAGGGACTCTTTGGTACAATACCCAGCATGCATGCTG

TGCCAGGGGCTGACAAGGGTGCTGTCCTTGGCTTCCCCATTTTGGAGTGGTCACTTG

CCTCTACTCCAGCCCCAGAAGTGGAAACTGAGATGATGTGTGGAGGAGAGAGCCAGC

GTTCATGTTGGGAATCTTGAGGCTCCTTTCCAGCTCTCAGATTCTGTGATGCTCAAAGG

GTGAGCTCTGTGGGCCCAGGACGCATGGTAGATGGAGCTTAGTCTTTCTGGTATCCAG

CTGGGAGCCAAGCACAGAACACGCATCAGTGTTTATCAAATGACTGAGGAAATGAATGA

ATGAATGTCTCCATCTCAACCCTCAGCCTGGTCCCTCCTTTTTTCCCTGCAGTTGGTAC

AGATGGCATTGTCCCAGTCTGTTCCCTTCTCGGCCACAGAGCTTCTCCTGGCCTCTGC

CATCTTCTGCCTGGTATTCTGGGTGCTCAAGGGTTTGAGGCCTCGGGTCCCCAAAGGC

CTGAAAAGTCCACCAGAGCCATGGGGCTGGCCCTTGCTCGGGCATGTGCTGACCCTG

GGGAAGAACCCGCACCTGGCACTGTCAAGGATGAGCCAGCGCTACGGGGACGTCCT

GCAGATCCGCATTGGCTCCACGCCCGTGCTGGTGCTGAGCCGCCTGGACACCATCCG

GCAGGCCCTG

The sequences of the primers used to amplify part of the CYP1A2 gene are as follows:

Forward primer: 5’ GAGAGCGATGGGGAGGGC 3’

Reverse primer: 5’ CCCTTGAGCACCCAGAATACC 3’

Find the binding sites for each of these primers in the above sequence. Calculate the expected size of the product (in base pairs) that will be amplified using this primer set and enter your answer below.

HINTS:

One primer will form complementary base pairs with the strand that is written here (so what will it look like relative to the sequence you have been given?)
The other primer will form complementary base pairs with the strand that is NOT written here (so what will it look like relative to the sequence you have been given?)
Each strand of newly synthesised DNA starts with a primer - so do you need to count the primer binding sites in your calculation of the product length?

Expert Solution

TGGGCTAGGTGTAGGGGTCCTGAGTTCCGGGCTTTGCTACCCAGCTCTTGACTTCTGT

TTCCCGATTTTA AATGAGCAGTTTGGACTAAGCCATTTTTAAGGAGAGCGATGGGGAGG

GCTTCCCCCTTAGCACAAGGGCAGCCCTGGCCCTGGCTGAAGCCCAACCCCAACCTC

CAAGACTGTGAGAGGATGGGGACTCATCCCTGGAGGAGGTGCCCCTCCTGGTATTGAT

AAAGAATGCCCTGGGGAGGGGGCATCACAGGCTATTTGAACCAGCCCTGGGACCTTG

GCCACCTCAGTGTCACTGGGTAGGGGGAACTCCTGGTCCCTTGGGTATATGGAAGGTA

TCAGCAGAAAGCCAGCACTGGCAGGGACTCTTTGGTACAATACCCAGCATGCATGCTG

TGCCAGGGGCTGACAAGGGTGCTGTCCTTGGCTTCCCCATTTTGGAGTGGTCACTTG

CCTCTACTCCAGCCCCAGAAGTGGAAACTGAGATGATGTGTGGAGGAGAGAGCCAGC

GTTCATGTTGGGAATCTTGAGGCTCCTTTCCAGCTCTCAGATTCTGTGATGCTCAAAGG

GTGAGCTCTGTGGGCCCAGGACGCATGGTAGATGGAGCTTAGTCTTTCTGGTATCCAG

CTGGGAGCCAAGCACAGAACACGCATCAGTGTTTATCAAATGACTGAGGAAATGAATGA

ATGAATGTCTCCATCTCAACCCTCAGCCTGGTCCCTCCTTTTTTCCCTGCAGTTGGTAC

AGATGGCATTGTCCCAGTCTGTTCCCTTCTCGGCCACAGAGCTTCTCCTGGCCTCTGC

CATCTTCTGCCTGGTATTCTGGGTGCTCAAGGGTTTGAGGCCTCGGGTCCCCAAAGGC

CTGAAAAGTCCACCAGAGCCATGGGGCTGGCCCTTGCTCGGGCATGTGCTGACCCTG

GGGAAGAACCCGCACCTGGCACTGTCAAGGATGAGCCAGCGCTACGGGGACGTCCT

GCAGATCCGCATTGGCTCCACGCCCGTGCTGGTGCTGAGCCGCCTGGACACCATCCG

GCAGGCCCTG

Forward primer: 5’ GAGAGCGATGGGGAGGGC 3’

Reverse primer: 5’ CCCTTGAGCACCCAGAATACC 3’

Reverse complement

GGTATTCTGGGTGCTCAAGGG

Amplified region is of 744 bp

gladiator answered 2 years ago

The sequence below represents the coding DNA strand of the start of a gene, including part...

The sequence below represents the coding DNA strand of the start of a gene, including part of the 5' untranslated region. (5')...TCGGAAGGAGGTAGCGGCAATGGGGAAAAGTATTGCTT...(3') In studying variants of this gene in disease, a nucleotide mutation of A→T was detected in the first base of the third codon. What effect would this mutation have? (When considering your answer, assume standard initiation of translation is numbered as codon 1.) Select one: a. Terminates translation b. No effect c. Disrupts ionic interactions at physiological pH...

1) The WILDTYPE DNA/gene has the base sequence: 5’GTACTGCAT3’ (the antisense strand of the gene is...

1) The WILDTYPE DNA/gene has the base sequence: 5’GTACTGCAT3’ (the antisense strand of the gene is shown) The gene has undergone a mutation. The mutant DNA/gene has the base sequence: 5’GTACTCCAT3’ (the mutation is in BOLD) based on this information, answer the following 1a)What is the base sequence of mutant mRNA? Label the ends of the mRNA 1b) this mutation is most likely to be caused by: a. soot b. analogues c. X-Ray d. RNA polymerase e. ribosome (pick one)...

Below is a DNA sequence of Borrelia burgdorferi containing the sequence of one strand only. 5’-ACTTCAGGATCCACTGGGCCCGAATTCGTCCTGAGCTCTAGAGTCCTTCG-3’...

Below is a DNA sequence of Borrelia burgdorferi containing the sequence of one strand only. 5’-ACTTCAGGATCCACTGGGCCCGAATTCGTCCTGAGCTCTAGAGTCCTTCG-3’ A) Please make the DNA double stranded by writing the complementary strand of the DNA underneath the strand above. B) Find in internet restriction sites for BamHI, EcoRI and XbaI. Please place a box around each restriction site in the DNA. C) You choose to cut this DNA with all three restriction enzymes. How many DNA fragments will you get? D) You choose to cut...

The following DNA sequence occurs in the nontemplate strand of a structural gene in a bacterium...

The following DNA sequence occurs in the nontemplate strand of a structural gene in a bacterium (the promoter sequence is located to the left but is not shown): 5’-GAATGTCAGAACTGCCATGCTTCATATGAATAGACCTCTAG-3’ Consider the ribonucleotide sequence of the mRNA molecule that is transcribed from this piece of DNA that you determined in the previous question. What is the amino acid sequence of the polypeptide encoded by this mRNA? You must show and explain all work/evidence to receive credit.

Multiple Choice: The nucleotide sequence below represents a gene along the length of part of a...

Multiple Choice: The nucleotide sequence below represents a gene along the length of part of a chromosome. Below the DNA is a pool of tRNA’s with their attached amino acids: the three nucleotides represent the anticodon and the number above each anticodon symbolizes a particular amino acid attached to that tRNA. Using your knowledge of the steps involved in how genes code for proteins, determine which of the amino acid (number) sequences below would correspond with the expected polypeptide chain...

Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the...

Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the boxed G/C base pair and proceeds from left to right. 5’-CCGATAAATGGCCGATTACGATATGCCAGATCATTACAACTAACGAGGCC -3’ 1 - - - - - - - - - - +- - - - - - - - - - -+- - - - - - - - - - +- - - - - - - - -+ - - - - - - - - - - - -+...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA strand look like? What would the protein look like? Create a point mutation in the DNA and then give the mRNA and protein sequence. Create a frameshift mutation in the DNA and then give the mRNA and protein sequence.

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3' T A C C G A T G G 5'

The base sequence of a polynucleotide chain is given as follows. This is the template strand...

The base sequence of a polynucleotide chain is given as follows. This is the template strand of a DNA molecule. Please answer the questions following the base sequence. 3’-TAC GGG CTA CAA CTT AAC AGA CCA ATC-5’ What will be produced if this DNA molecule is replicated? What are the anticodon sequences of the tRNA molecules that can carry these amino acids? If this DNA got a mutation that changed the first 3 bases to 3'-ATT-5', what will happen to...

Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons...

Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3 base pairs long. AUG CAC UGU CCU UUC GCU GAC GAG AUC UGG UUG GAA UCG The following are pieces of mRNA. Give the DNA strand from which it was transcribed. mRNA: G A G A U C U G G U U G G A A U C G DNA : Using the following piece of DNA, give the mRNA molecule,...