You want to use PCR to amplify a 1Kb exon of the human autosomal gene phenylalanine...

You want to use PCR to amplify a 1Kb exon of the human autosomal gene phenylalanine hydroxylase (PH) from the genome of a person suffering from the disease phenylketonuria, which is due to this enzyme not functioning.

a) You start with 1 nanogram of genomic DNA in your sample tube. Assuming a human haploid genome is 3 x 10⁹ bp, and each bp has a mass of 660 g/mole, how many moles of haploid genomes are present at the start of your PCR experiment?

b) The PH gene is present in a single copy in the haploid genome. How many template molecules of the PH gene are present at the start of your PCR experiment? (Give your answer in molecules, not moles of molecules.)

c) You set your PCR machine to run for 25 cycles to amplify your 1 kb fragment. Assume every cycle exactly doubles your desired target DNA. At the end of your 25 cycles, how much amplified DNA have you created, in terms of number of molecules AND mass of DNA?

Expert Solution

Handwritten solution is given below for the given problem:

gladiator answered 1 year ago

You want to use PCR to amplify a 1Kb exon of the human autosomal gene phenylalanine...

You want to use PCR to amplify a 1Kb exon of the human autosomal gene phenylalanine hydroxylase (PH) from the genome of a person suffering from the disease phenylketonuria, which is due to this enzyme not functioning. a) You start with 1 nanogram of genomic DNA in your sample tube. Assuming a human haploid genome is 3 x 109 bp, and each bp has a mass of 660 g/mole, how many moles of haploid genomes are present at the start...

a. If you are asked to amplify exon 3 of beta hemoglobin gene how you would...

a. If you are asked to amplify exon 3 of beta hemoglobin gene how you would do this? (points: 6) b. PCR revolutionized molecular biology-explain. (points: 4)

. If you are asked to amplify exon 3 of beta hemoglobin gene how you would...

. If you are asked to amplify exon 3 of beta hemoglobin gene how you would do this? . PCR revolutionized molecular biology-explain. . Describe events occurring in the C4 cycle of photosynthesis. Why C4 cycle is a good adaptation for certain plants.

You are planning to use PCR to amplify several regions of a piece of DNA. The...

You are planning to use PCR to amplify several regions of a piece of DNA. The sequence of your template DNA is provided below along with the sequences of all available primers. Determine where each of the primers bind and answer the following: 5' AGGGCCAAATGAGATGAGTCAAAAGCTGCCGATAACCGGATAG 3' 3' TCCCGGTTTACTCTACTCAGTTTTCGACGGCTATTGGCCTATC 5' Primer 1: 5-TTGGCC 3 P2: 5-GTCAAA-3 p3: 5-AACCGG-3 p4: 5-CCGGTT-3 P1 can bind to the bottom strand? P4 can bind to the molecule at only one location Which primer pair would...

I am writing a lab report on the a nested PCR to amplify the GAPC gene...

I am writing a lab report on the a nested PCR to amplify the GAPC gene of two plants. I wrote a very small introduction on the process of nestedPCR and its specificty but i dont know what else i should incorporate. Can somone help me on how i should write my intoduction what info to use ?

In the PCR exercise you described why we amplify the 16s ribosomal RNA gene. What other genes...

In the PCR exercise you described why we amplify the 16s ribosomal RNA gene. What other genes might help us to identify specific bacteria? In other words, what traits could be sequenced that are unique to bacteria?

You decide to use RT-PCR to confirm your predictions about the exon organization of the 2...

You decide to use RT-PCR to confirm your predictions about the exon organization of the 2 mRNAs in tissue such as heart and epidermis. Describe in general the experiment you would do, specifying where your PCR primers would be designed to bind. What results would you expect. Please be specific

3) How can you use PCR to clone a 2000bp gene into a plasmid vector?

1. ⦁ Your supervisor has asked you to desine PCR primers to amplify the following region...

1. ⦁ Your supervisor has asked you to desine PCR primers to amplify the following region in the human genome. 5’- CGTTCGTAATCTTGGTGAATTAATCCGATGTAGTGAAGA GGCGGCCACTGAGCAACAGTGATTGTGTGCTGCTGTGTC TCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCC TGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTG AACCACTGAACCACAGCTACCAAGCCATCATCATGCTAT GGATGCTTGCATTACCAAGGCAAGCT -3’ Here is the sequence for the forward/right primer. 5’- CGTTCGTAATCTTGGTGAATTAAT-3’ a) Was this primer designed to bind the DNA strand given above or the complementary strand? Hint: you may want to write out the complementary sequence to this DNA sequence to help you answer this question. b) Underline the bases where this...

Describe how you can use PCR to obtain a gene fragment X that can be cloned...

Describe how you can use PCR to obtain a gene fragment X that can be cloned into a plasmid vector for expression of the recombinant protein. Include in your description how the PCR reaction will be performed, how the amplicon will be analyzed, the use of restriction enzymes, how cloning will be achieved, how you will know that you have a recombinant containing the insert gene fragment X and how you will detect the recombinant protein.

Question

You want to use PCR to amplify a 1Kb exon of the human autosomal gene phenylalanine...

Solutions

Expert Solution

Related Solutions

You want to use PCR to amplify a 1Kb exon of the human autosomal gene phenylalanine...

a. If you are asked to amplify exon 3 of beta hemoglobin gene how you would...

. If you are asked to amplify exon 3 of beta hemoglobin gene how you would...

You are planning to use PCR to amplify several regions of a piece of DNA. The...

I am writing a lab report on the a nested PCR to amplify the GAPC gene...

In the PCR exercise you described why we amplify the 16s ribosomal RNA gene. What other genes...

You decide to use RT-PCR to confirm your predictions about the exon organization of the 2...

3) How can you use PCR to clone a 2000bp gene into a plasmid vector?

1. ⦁ Your supervisor has asked you to desine PCR primers to amplify the following region...

Describe how you can use PCR to obtain a gene fragment X that can be cloned...