Speculate on the effects of a drug that competitively blocks ATP binding site in the RSC...

Speculate on the effects of a drug that competitively blocks ATP binding site in the RSC complex in yeast based on nucleosomal remodeling.

Expert Solution

Drug that competitively block the ATP binding site in the RSC complex will lead to decreased functioning of polymerase and less or decreased expression of gene.

Explanation

histone acetyltransferases (HATs) work in coordination with ATP-dependent chromatin remodeling enzymes which affect promoter-dependent transcription initiation of gene thus regulating gene expression.

RSC is a bromodomain-containing ATPase. During transcription in yeast RNA polymerase II (Pol II) arrests at positioned mononucleosome. RSC use energy release by ATP hydrolysis, stimulates passage of Pol II through these sites thus facilitate expression of gene.

If we use drug that competitively block ATP binding site thus on RSC protein. Than RSC will not able to function with out hydrolysis of ATP and will not be able to stimulate polymerase thus not able to stimulate expression of gene.

gladiator answered 2 years ago

1a. The term “transcription factor binding site” (aka TF binding site) refers to __

1a. The term “transcription factor binding site” (aka TF binding site) refers to __1b. Transcription factor binding sites are often found where within genomic DNA?1c. Transcription factor binding sites could be referred to as cis-acting elements because __1d. Transcription factors (both activators and repressors) could also be referred to as trans-acting factors because __ Terms Lac operon Operator Repressor protein CAP (catabolite activator protein) Trans acting factors vs. Cis acting elements Transcription factor Transcriptional activator vs. repressor DNA-binding domain Transcription factor binding site Activation vs. Repression domains Chromatin Nucleosome 10nm- vs. 30nm-fibers Euchromatin vs. heterochromatin Histones...

explain the distinction between binding site and binding region

Draw an IgG molecule and identify the following parts: Antigen-binding site Complement-binding region Macrophage-binding site Variable...

Draw an IgG molecule and identify the following parts: Antigen-binding site Complement-binding region Macrophage-binding site Variable region Hinge region

What features of the binding site hinder oxygen binding to Hb? What feature of the binding...

What features of the binding site hinder oxygen binding to Hb? What feature of the binding site facilitates oxygen binding to Hb? Explain the Bohr effect using the theory of allosteric modulation of oxygen binding to hemoglobin.

What is in the last effects, the nuclear binding energy per atom, and the binding energy...

What is in the last effects, the nuclear binding energy per atom, and the binding energy per nucleon for U-238? (Isotopic mass of U-238=238.05078 amu)

Discuss protein binding, what it means, what are the implications of a drug protein binding percentage...

Discuss protein binding, what it means, what are the implications of a drug protein binding percentage and how the protein binding impacts how drugs may interact with each other and the subsequent effect on the patient (provide 2 explicit examples). And, then explain what will happen if the patient is malnourished. what are ED50 , LD50, TD50: and explain in detail why the matter. Please give 2 examples of each.

2. (6 pts) Speculate on the effects of each of the following mutations on the translation...

2. (6 pts) Speculate on the effects of each of the following mutations on the translation of the following mRNA. Specifically indicate whether any product would be made, and if so, if it would be altered in any way. (GpppG is the 5’ cap) 5’GpppGUAACAUGGUCGGACCAUGAC(A)2003’ Mutation that removes the editing pocket from isoleucine-tRNA synthetase. Mutation that prevents GTP hydrolysis of eEF1-a. Mutation that prevents binding of GTP by eEF2.

If a histidine sidechain in a binding site is protonated in the free protein, but deprotonated...

If a histidine sidechain in a binding site is protonated in the free protein, but deprotonated in the ligand-bound state, how would pH affect the interaction? A.) No effect B.) Lower Kd at lower pH C.) Higher Kd at lower pH D.) Only ΔH would change with pH

DCMU is marketed as an algicide and an herbicide. It works by blocking the binding site...

DCMU is marketed as an algicide and an herbicide. It works by blocking the binding site for plastoquinone on photosystem II. If DCMU blocks plastoquinone from binding to photosystem II then in what state (oxidized or reduced) will the chlorophyll a of photosystem II be stuck? Why? Based on your answer above, in what state would plastoquinone be stuck? Why? Considering where DCMU binds, would plants in nature exposed to DCMU be able to produce ATP and NADPH through the...

List the harmful effects caused by alcohol/drug abuse. Ans. Harmful effects caused by alcohol/drug abuse. Drug...

List the harmful effects caused by alcohol/drug abuse. Ans. Harmful effects caused by alcohol/drug abuse. Drug abusers who take it intravenously may cause

Question