during what prosses id complementary dna made

Expert Solution

Complementary DNA or cDNA is DNA produced on an RNA template by the action of reverse transcriptase (RNA-dependent DNA-polymerase). Then sequence of the cDNA becomes complementary to the RNA sequence.

bacterial cells are used to synthesize copies of eukaryptic proteins. .but there is one problem in eukaryotic gene or dna ..

in eukaryotic dna there is introns present ,which prokaryotic cell cannot remove ..so if we provide prokaryotic cell such Dna , it won't be able to form proteins copy. .

to overcome this problem...eularyotic mRNA is provided( no introns present in it ) ..from this cdna complementary are formed.then rnase H digest few part of rna.nd from these cdna complementary dna formed...now this ds dna provided to bacterial cell which can now easily transcribe and translate...

gladiator answered 2 years ago

1. What would the complementary strand of DNA be for these strands of DNA? (1 point...

1. What would the complementary strand of DNA be for these strands of DNA? (1 point each; 5 points total) a. 5’ – AGCTTGCATGGCTATT – 3’ b. 3’ – GCAATGGGCGCT – 5’ c. 3’ – AAATCCGATGCGCTA – 5’ d. 5’ – GCAGCAGCATTGCA – 3’ e. 3’ – GCAATCGCCGGTGCAC – 5’ 3 During what portion of the cell cycle does DNA replicate? How many times does DNA replicate before mitosis? How many times does DNA replicate before meiosis? (3 points) 4...

If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?

1. What is a primer? What are they made out of during DNA replication? Why does...

1. What is a primer? What are they made out of during DNA replication? Why does the process of DNA replication require the use of a primer? 2. When an agarose gel is set up, the DNA samples are put at one end of the gel and the pieces of DNA migrate toward the other end. a. At what end are the DNA samples put? (1 point) b. Toward what end do the DNA samples migrate? (1 point) c. What...

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3' T A C C G A T G G 5'

What would happen if there were an error in the DNA complementary base pairing? explain.

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA strand look like? What would the protein look like? Create a point mutation in the DNA and then give the mRNA and protein sequence. Create a frameshift mutation in the DNA and then give the mRNA and protein sequence.

Question

during what prosses id complementary dna made

Solutions

Expert Solution

Related Solutions