1. Which DNA sequence is recognized first to initiate transcription in eukaryotes? A. TATA box B....

1. Which DNA sequence is recognized first to initiate transcription in eukaryotes?

A. TATA box

B. poly A sequence

C. coding sequence

D. enhancer

2. Strand initiation in DNA replication is accomplished when the enzyme primase lays down a primer. In prokaryotes, of what molecule is that primer composed?

A. DNA

B. RNA

C. protein

D. lipid

Solutions

Expert Solution

1. TATA box is the DNA sequence that is recognized first to initiate transcription in eukaryotes. on the other hand, six nucleotides long Pribnow box is the sequence that is recognized first to initiate transcription in prokaryotes. The TATA box does not code for a protein sequence. Hence, it is a non-coding sequence. During the synthesis of mRNA, the poly-A tail is added to the 3' end of pre mRNA. poly-A sequence is a sequence at which cleavage before the addition of the poly-A nucleotides is done. The coding sequence is the sequence that codes for the protein. The enhancer is the sequence at which activators bind to increase the rate of transcription.

2. Primer is composed of RNA in both prokaryotes and eukaryotes. Primer is a small RNA sequence synthesized by primase. Primer is required for strand initiation in DNA replication as DNA polymerase cannot synthesize DNA from the starting. It can only add nucleotides to the RNA primer existing on DNA template strand.

gladiator answered 1 year ago

Next > < Previous

Related Solutions

Eukaryotic gene regulation: transcription initiation Initiation & the transcription initiation complex (including enhancers). Promoter; TATA box;...

Eukaryotic gene regulation: transcription initiation Initiation & the transcription initiation complex (including enhancers). Promoter; TATA box; Conserved & variable regions in promoters. Eukaryotic enhancers. Why is it important that there are multiple control elements in a single enhancer? What binds to the control elements? How is it possible for a small number of activator and transcription factor proteins to regulate a large number of genes? Transcription: Elongation & RNA polymerase. RNA polymerase vs. DNA polymerase. Termination. MyoD: What makes it...

Regulation of mRNA transcription in eukaryotes is tightly regulated. Describe the elements (regions of the DNA)...

Regulation of mRNA transcription in eukaryotes is tightly regulated. Describe the elements (regions of the DNA) involved and what their function is. Describe the transcription factors (proteins) involved in initiating transcription.

The N-terminal signal sequence for secreted proteins in eukaryotes is recognized by Group of answer choices...

The N-terminal signal sequence for secreted proteins in eukaryotes is recognized by Group of answer choices the ribosome. the signal recognition particle. the endoplasmic reticulum the SecYEG translocon.

Which of the following is/are true about DNA replication? A) Primase is needed to initiate DNA...

Which of the following is/are true about DNA replication? A) Primase is needed to initiate DNA replication on both the leading strand and the lagging strand. B) The sliding clamp is loaded once on each DNA strand, where it remains associated until replication is complete. C) Telomerase carries its own DNA molecule to use as a primer at the end of the lagging strand. D) Primase requires a proofreading function that ensures there are no errors in the RNA primers...

During eukaryotic transcription, TFIID recognizes and binds the ____ box in the DNA. The technique initially...

During eukaryotic transcription, TFIID recognizes and binds the ____ box in the DNA. The technique initially used in the identification of promoter sequences was ________________. A more contemporary technique for identification of promoter sequences is the _________ _____________________ assay.

Which of the following is(are) not cis-acting? a. lacI b. lacO c. TATA box d. Enhancers e. Items a and b are not cis-acting

Which of the following is(are) not cis-acting? a. lacI b. lacO c. TATA box d. Enhancers e. Items a and b are not cis-acting f. There is not enough information to determine this

Which of the following aspect of translation applies to eukaryotes but not prokaryotes? a.)Transcription and translation...

Which of the following aspect of translation applies to eukaryotes but not prokaryotes? a.)Transcription and translation without exception occur in the same cellular space and at the same time. b.)Their ribosomal subunits contain one less rRNA, fewer polypeptides, and have lower molecular weights. c.)A pre-mRNA is processed at each end and spliced to become a mature mRNA transcript. d.)tRNAs and rRNAs undergo processing to achieve their mature, functional form. e.)A single mRNA transcript may contain several coding regions that encode...

1. Which of the following statements is TRUE regarding transcription in Eukaryotes? pre-mRNAs are most susceptible...

1. Which of the following statements is TRUE regarding transcription in Eukaryotes? pre-mRNAs are most susceptible to degradation in the nucleus after addition of the poly(A) tail The template strand of DNA is utilized by RNA polymerase II to transcribe a gene The entire mRNA molecule produced during transcription is ultimately translated into protein dNTPs are utilized by RNA polymerase II during the elongation phase of transcription Mutations in the Kozak sequence will result in inability of RNA polymerase II...

I discovered a new transcription activator (a protein that binds a specific DNA sequence at promoters...

I discovered a new transcription activator (a protein that binds a specific DNA sequence at promoters of genes) and helps bring in the SWI/SNF complex to the promoters of 200 genes. What would be the affect on chromatin organization and gene expression at these genes if I mutate the transcription activator such that it no longer is able to bind DNA?

On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding...

On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding strand and which one is the template for the transcription 3. Write down the mRNA 4. Write down the protein clearly indicating the first codon on the mRNA(hint: find the Kozak sequence RCCAUGG to identify the first codon) 5. Introduce a nonsense mutation 3' AGTCGACTGGCATCAGACTACGCTGTGACTGATACGCGTTTTATTGGATCGCACCGCATACAGGGCCCCGGTACCGTCCAAAACT CCCGAGTAGTCAGATGTCAGCAGCGAAATATACGG 5' 5'TCAGCTGACCGTAGTCTGATGCGACACTGACTATGCGCAAAATAACCTAGCGTGGCGTATGTCCCGGGGCCATGGCAGGTTTTGAGGGCTCATCAGTCTACAGT CGTCGCTTTATATGCC 3'

Subjects