Question

In: Biology

What is RFLP (restriction fragment length polymorphisms)? Explain how RFLPs are used as one of the...

  1. What is RFLP (restriction fragment length polymorphisms)? Explain how RFLPs are used as one of the tools for “Fingerprinting” of an individual’s DNA.

Solutions

Expert Solution

  • Restriction fragment length polymorphism (RFLP) is a method which would exploit the polymorphisms (a variation in homologous DNA sequences) in order to distinguish individuals or to point out the location of genes within a sequence.
  • In RFLP analysis, a DNA sample is digested into fragments using restriction enzymes and the resulting restriction fragments are separated using gel electrophoresis according to their size.

RFLPs are used as one of the tools for Fingerprinting of an individual’s DNA.

  • The principle of RFLP in DNA fingerprinting is that any genomic DNA can be differentiated according to the presence or absence of restriction enzyme sites.DNA is unique to an individual so we can use DNA fingerprinting to match genetic information.The restriction fragment length polymorphism method cut out genes which are likely to be differentiating factors using restriction enzymes.

PROCEDURE OF DNA FINGERPRINTING BY RFLP METHOD:-

  1. Obtain a sample of cell (skin, hair, blood cells which contain DNA). The DNA is extracted from the cells and purified.
  2. The DNA is then cut at specific points restriction enzymes.The enzymes produced fragments of varying lengths that were sorted by placing them on a gel and then subjecting the gel electrophoresis.
  3. The sorted double stranded DNA fragments are then subjected to a blotting technique.Here they were split into single strands and transferred to a nylon sheet.
  4. The fragments undergoes autoradiography by which they were exposed to DNA probes.A piece of X-ray film was then exposed to the fragments and a dark mark was produced at any point where a radioactive probe had become attached.The resultant pattern of marks could be analyzed.

Related Solutions

If a circular plasmid is cut one with a restriction enzyme what is the result? how...
If a circular plasmid is cut one with a restriction enzyme what is the result? how do we determine how many times a restriction enzyme cut.
What is used to “digest” DNA? Select one: A. Agarose powder B. Restriction enzymes C. TAE...
What is used to “digest” DNA? Select one: A. Agarose powder B. Restriction enzymes C. TAE buffer D. Pipettes What is DNA’s electrical charge? Select one: A. Positive B. Alternating (Both positive and negative) C. Negative D. Neutral EcoRI recognizes which of the following sequences of DNA nucleotides? Select one: A. 5’ CCTTAAG 3’ B. 5’ GGCC 3’ C. 5’ GAATTC 3’ D. 5’ UUCGTA 3’ Scientists originally used __________ to create DNA profiles of individuals. Select one: A. EKROLs...
Explain two methods that can be used to ligate restriction products of a gene of interest...
Explain two methods that can be used to ligate restriction products of a gene of interest with the products having blunt ends
Design a strategy to clone the full length of the DNA fragment shown below in the...
Design a strategy to clone the full length of the DNA fragment shown below in the BamHI site of pBRT322 A plasmid vector. Note: The internal restriction sites of the fragment have been underlined. Describe the strategy in detail, and show the sequences of any primer(s) (if needed) you propose to use. 5’TACTGATTCCAAAACTAAAGGATCCAAAAAAAAACTGCAGAAACCGAATCTCTCCA3'
Design a strategy to clone the full length of the DNA fragment shown below in the...
Design a strategy to clone the full length of the DNA fragment shown below in the BamHI site of pBRT322 A plasmid vector. Note: The internal restriction sites of the fragment have been underlined. Describe the strategy in detail, and show the sequences of any primer(s) (if needed) you propose to use. 5’TACTGATTCCAAAACTAAAGGATCCAAAAAAAAACTGCAGAAACCGAATCTCTCCA3'
What are restriction enzymes, and why are they used in recombinant DNA technology? (3 marks)
What are restriction enzymes, and why are they used in recombinant DNA technology?
4. What is an Okazaki fragment and explain why it is found only in the lagging...
4. What is an Okazaki fragment and explain why it is found only in the lagging strand in a replication fork, but not the leading strand. 5. What is the role of a telomerase in eukaryotes and why are they not needed in bacterial cells? 6. Using a translation table, there is only one possible sequence of nucleotides in the template strand of DNA listed below that would code for the polypeptide sequence Phe-Leu-Ile-Val. Identify the correct one and explain...
Explain what one-sample hypothesis testing is used for and why it is used
Explain what one-sample hypothesis testing is used for and why it is used
Accurately describe the two restriction enzymes (EcoRI and HindIII). Both restriction enzymes were used for Gel...
Accurately describe the two restriction enzymes (EcoRI and HindIII). Both restriction enzymes were used for Gel Electrophoresis.
Explain asset restriction of regulation. (What central bank can do with it )
Explain asset restriction of regulation. (What central bank can do with it )
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT