Question

In: Biology

After designing PCR primers, what next steps should be done? Explain briefly.

After designing PCR primers, what next steps should be done? Explain briefly.

Solutions

Expert Solution

Designing the PCR is one of the initial step of PCR

Once the forward and reverse primers are ready we can move to the main steps of PCR reaction which is as follows.

1. Load the DNA sample in PCR tubes in required concentration and volume. 100ng/μl is the usual concentration preferred.

2. In another tube with required concentration add PCR buffer, primers, enzyme and distilled water. This would be the master mix. The volume of each of the components added should be multiplied with the total number of samples so that, it would easier to aliquot the master mix in each PCR tube.

Example if there are 30 samples and the volume of each components required in one tube should be multiplied with 30.

3. Add the required amount of mastermix into each tube.

Example if the total volume is 20 μl and 1 μl is the template DNA sample then add 19μl of master mix into each tube such that each tube will have 20μl in total.

4. Close the cap of the PCR tubes and spin down the master mix to the bottom of the tubes.

5. Programme appropriate thermal protocol in PCR machine and run the reaction. The thermal protocol depends on your experiment.

Example:

Initial Denaturation - 95°C - 2 minutes

Denaturation -  94°C - 30 seconds

Annealing - 60°C - 30 seconds

Extension - 72°C - 30 seconds

Final Extension - 72 °C - 10 minutes

Hold - 10°C

6. After amplification completion, you can resolve the PCR product in 2% agarose gel electrophoresis to check
the amplification.

Thank you!


Related Solutions

What are PCR primers? Briefly discuss how primers can be designed
What are PCR primers? Briefly discuss how primers can be designed
We received primers for use in our next PCR experiment. The primers arrived lyophilized (a dry...
We received primers for use in our next PCR experiment. The primers arrived lyophilized (a dry powder) at 30 nanomoles per tube in a 2ml tube (the volume of the powder is negligible for this problem). The primers must be rehydrated (dissolved) in nuclease-free water. You have only 5 ml of nuclease-free water. We need 30 tubes for class containing 2 ul of primer in each tube at a concentration of 50 nM. Do you have enough for class? If...
Explain what PCR is (p. 205) (Tablet p.233) b. Explain the role of primers, dNTPs, Taq...
Explain what PCR is (p. 205) (Tablet p.233) b. Explain the role of primers, dNTPs, Taq polymerase and buffer in the reaction (Practical)
Design primers for the following target sequence which is to be amplified using PCR: CGGCTATCAGGATTGTTCTCTGGACCGTACATCGAACGGCTATCGAGGATTGTTCTCTGGACCGTACATTAAA Explain...
Design primers for the following target sequence which is to be amplified using PCR: CGGCTATCAGGATTGTTCTCTGGACCGTACATCGAACGGCTATCGAGGATTGTTCTCTGGACCGTACATTAAA Explain how you went about designing them.
Define and explain their function in a PCR Reaction a) DNA polymerase b) Primers c) dNTPs...
Define and explain their function in a PCR Reaction a) DNA polymerase b) Primers c) dNTPs d) MgCl2 e) DNA
What are the differences in proteins, primers, and experimental procedures for the following PCR based experiments?...
What are the differences in proteins, primers, and experimental procedures for the following PCR based experiments? a. SYBR Green qRT-PCR b. RAPD c. Immuno qRT-PCR d. PCR-OLA e. Taqman Assay
What are the steps in designing a Research Project?
What are the steps in designing a Research Project?
Real time PCR: how is it analyzed? what can be done to improve real time PCR?...
Real time PCR: how is it analyzed? what can be done to improve real time PCR? How do you know if the bullfight was good or not? What does it mean if the real time parameters are high, low, or if there were faults in something in the process seeing the results? Abound in your response. Real time pcr: • How to do? • How it is interpreted? • How it is optimized
Explain how PCR (polymerase chain reaction) works. After explaining PCR, compare PCR to the DNA replication...
Explain how PCR (polymerase chain reaction) works. After explaining PCR, compare PCR to the DNA replication that occurs naturally in living cells, making sure to give at least 4 similarities and 4 differences.
Explain in detail each of the steps of PCR involved in the amplification of a specific...
Explain in detail each of the steps of PCR involved in the amplification of a specific region of DNA
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT