Question

In: Biology

What are PCR primers? Briefly discuss how primers can be designed

What are PCR primers? Briefly discuss how primers can be designed

Solutions

Expert Solution

What are PCR primers?
A short stretch of single strandard oligo nucleotide which initiate the DNA replication by hybriding to its correspondense sequence in invitro are called as primers. In general the PCR primers are deoxy oligonucleotide primers.

------------------------------------------------------------------------------------------------------------------------------------------------

Briefly discuss how primers can be designed.
The main important characters in the primer designing are
1. Length of the primer: The optimal length of the primer is 15-20 bp. Some reports suggested that the lenght of the primer is alos effects the amplicon length also.

2. Melting temperature:
The optimum melting temperature is 52-58 Degrees Celcius. Based on the Tm of the primer we can find the aneeling temperatrue also. If the metling temperatre is more than 65 degress, there is a chance of secondary annealing. So, to avoid this max primer are bulid with ~55 degrees of Tm.

3. GC content: The optimum GC content in the primer sequence is around 45-60%.

4. GC clamp: G and C presence in the last five bases at 3' end helps in specific binding etc promoter sepcific binding. So, based on the amplicon character, its need to be added.

5. Dimerization of the primer: Self and cross dimerzation of the primer effects the stability of the primer and pcr reaction. It avoid this, in primer desing self and cross dimerization have to be avoided.

6. Nucleotide repeats: Di or tri nucleotide repreats causes mispriming hence it should be avoided.

7. Nucleotide Runs: Single bases runs should be avoided, this may also leads to mispriming.

Now using primer desinging software with all these specific parameters you can generate the requeired primer for PCR instantly.


Related Solutions

How to Design Primers for PCR
 How to Design Primers for PCR The lab report should also have the following criteria Introduction, Principle, and procedure.
After designing PCR primers, what next steps should be done? Explain briefly.
After designing PCR primers, what next steps should be done? Explain briefly.
Discuss how important primers are in a biochemical context. How do primers work?
Discuss how important primers are in a biochemical context. How do primers work?
We received primers for use in our next PCR experiment. The primers arrived lyophilized (a dry...
We received primers for use in our next PCR experiment. The primers arrived lyophilized (a dry powder) at 30 nanomoles per tube in a 2ml tube (the volume of the powder is negligible for this problem). The primers must be rehydrated (dissolved) in nuclease-free water. You have only 5 ml of nuclease-free water. We need 30 tubes for class containing 2 ul of primer in each tube at a concentration of 50 nM. Do you have enough for class? If...
What are the differences in proteins, primers, and experimental procedures for the following PCR based experiments?...
What are the differences in proteins, primers, and experimental procedures for the following PCR based experiments? a. SYBR Green qRT-PCR b. RAPD c. Immuno qRT-PCR d. PCR-OLA e. Taqman Assay
In polymerase chain reaction, what is a primer and how can we change the primers to...
In polymerase chain reaction, what is a primer and how can we change the primers to change the target sequence? I thought in PCR the DNA was just copied. I'm having trouble understanding that a specific sequence can be copied. I cant find videos to show me this process as I am really interested to see how this works. Please help me understand this part. Thank you.
Real time PCR: how is it analyzed? what can be done to improve real time PCR?...
Real time PCR: how is it analyzed? what can be done to improve real time PCR? How do you know if the bullfight was good or not? What does it mean if the real time parameters are high, low, or if there were faults in something in the process seeing the results? Abound in your response. Real time pcr: • How to do? • How it is interpreted? • How it is optimized
Can you please explain how to get the primers?
Can you please explain how to get the primers?
Explain what PCR is (p. 205) (Tablet p.233) b. Explain the role of primers, dNTPs, Taq...
Explain what PCR is (p. 205) (Tablet p.233) b. Explain the role of primers, dNTPs, Taq polymerase and buffer in the reaction (Practical)
Design primers for the following target sequence which is to be amplified using PCR: CGGCTATCAGGATTGTTCTCTGGACCGTACATCGAACGGCTATCGAGGATTGTTCTCTGGACCGTACATTAAA Explain...
Design primers for the following target sequence which is to be amplified using PCR: CGGCTATCAGGATTGTTCTCTGGACCGTACATCGAACGGCTATCGAGGATTGTTCTCTGGACCGTACATTAAA Explain how you went about designing them.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT