Explain what PCR is (p. 205) (Tablet p.233) b. Explain the role of primers, dNTPs, Taq...

Explain what PCR is (p. 205) (Tablet p.233)
b. Explain the role of primers, dNTPs, Taq polymerase and buffer in the reaction
(Practical)

Solutions

Expert Solution

pcr is polymerase chain reaction. It is a technique that is used to amplify single copy or few copies of segment of DNA.

There are three steps involved i.e denaturatin - denature the DNA, annealing - ,cools the temperature that helps the primer to bind to the complementary sequence of single strand DNA, extention - raise the temperature and taq polymerise helps primer to extend.

role of primer - these are short pieces of single stranded DNA usually 20 nucleotides in length. There are two primers, they are designed so that they flank the targeted region of DNA. That is they are given sequence that makes them to bind to opposite strand of template DNA. It binds to complementary base pairing.

dntp - these are building blocks. These are monomeric blocks

taq polymerase - thermostable DNA polymerise. It attaches nucleotide to the DNA template thereby coping the dna

buffer - balances the ph . It creates an optimal condition for activity of taq dna polymerase.

gladiator answered 1 year ago

Next > < Previous

Related Solutions

Define and explain their function in a PCR Reaction a) DNA polymerase b) Primers c) dNTPs...

Define and explain their function in a PCR Reaction a) DNA polymerase b) Primers c) dNTPs d) MgCl2 e) DNA

What are PCR primers? Briefly discuss how primers can be designed

After designing PCR primers, what next steps should be done? Explain briefly.

During aPCR reaction, what would be the function of Taq DNA polymerase? extends the primers into...

During aPCR reaction, what would be the function of Taq DNA polymerase? extends the primers into full-length PCR product (i.e. copies the DNA) unwinds dsDNA template ensures DNA is negatively charged for gel electrophoresis cuts DNA into fragments assists primers in annealing to the template

What are the three stages of PCR? What happens? At what temperature? What is Taq polymerase...

What are the three stages of PCR? What happens? At what temperature? What is Taq polymerase and why is it important? What are all the necessary reagents for PCR? What are primers and how do they bind?

Design primers for the following target sequence which is to be amplified using PCR: CGGCTATCAGGATTGTTCTCTGGACCGTACATCGAACGGCTATCGAGGATTGTTCTCTGGACCGTACATTAAA Explain...

Design primers for the following target sequence which is to be amplified using PCR: CGGCTATCAGGATTGTTCTCTGGACCGTACATCGAACGGCTATCGAGGATTGTTCTCTGGACCGTACATTAAA Explain how you went about designing them.

Question