For each of the following degree sequences, determine if the exists a graph whose degree sequence...

For each of the following degree sequences, determine if the exists a graph whose degree sequence is the one specified. In each case, either draw a graph or explain why no such graph exists.

a. (5,4,3,2,1)

b. (5,4,3,3,2,1)

c. (5,5,4,3,2,1)

Please show work - Discrete Mathematics - THANKS

Expert Solution

Colby Messinger answered 2 years ago

Find sequences that satisfy the following or explain why no such sequence exists: a) A sequence...

Find sequences that satisfy the following or explain why no such sequence exists: a) A sequence with subsequences converging to 1, 2, and 3. b) A sequence that is bounded above, but has no convergent subsequence. c) A sequence that has a convergent subsequence but is unbounded (note: unbounded means not bounded below or not bounded above. d) A sequence that is monotonic and bounded, but does not converge.

Questions in Graph Theory: In the subject of the degree sequence of graph, answer the following:...

Questions in Graph Theory: In the subject of the degree sequence of graph, answer the following: When does a d-regular graph have an Eulerian trail? and When does it have an Eulerian circuit? Note: a d-regular graph is one with degree sequence (d, d, d, . . . , d) for example. Can a tree be a regular graph? Why or why not

Question 1 - Infinite Sequences. (a). Determine an infinite sequence that satisfies the following . ....

Question 1 - Infinite Sequences. (a). Determine an infinite sequence that satisfies the following . . . (i) An infinite sequence that is bounded below, decreasing, and convergent (ii) An infinite sequence that is bounded above and divergent (iii) An infinite sequence that is monotonic and converges to 1 as n → ∞ (iv) An infinite sequence that is neither increasing nor decreasing and converges to 0 as n → ∞ (b). Given the recurrence relation an = an−1 +...

For each of the following sequences find a functionansuch that the sequence is a1, a2, a3,...

For each of the following sequences find a functionansuch that the sequence is a1, a2, a3, . . .. You're looking for a closed form - in particular, your answer may NOT be a recurrence (it may not involveany otherai). Also, while in general it is acceptable to use a "by cases"/piecewise definition, for this task you must instead present a SINGLE function that works for all cases.(Hint: you may find it helpful to first look at the sequence of...

Draw a graph with tow componets that has degree sequence (1,1,1,1,1,3,3,3)

6. The following sequences are mutations of the template sequence in question 1. For each mutated...

6. The following sequences are mutations of the template sequence in question 1. For each mutated sequence, indicate the new amino acid sequence produced and the type of mutation that is the end result in the amino acid (frameshift, Missense, nonsense, silent) as well as the type of mutation that occurred in the DNA sequence (substitution, addition, deletion) Template sequence question 1: 3’ TACCCTGGTGGTTTGCGGACT 5’ a. 3’ TAC CCG GTG GTT TGC GGACT 5’ b. 3’ TAC ACT GGTGGTTTGCGGACT 5’...

Which of the following graphs best illustrates the graph of a fifth degree polynomial function whose leading coefficient is positive?

Which of the following pairs of mRNA sequences is translated to the same protein sequence ?...

Which of the following pairs of mRNA sequences is translated to the same protein sequence ? Answer UUA UAU CGU CGG CUU UAC AGA AGG Using UCSC genome browser, find out the name of the human gene which is located within the genomic region chr21:38,785,658-38,844,604 of hg38 human genome version ? Answer: ETS2 I know the answer but I dont know how to solve them can you show me how to solve them please step by step its for bioinformatics

In sequences and series what is a sequence and what is a series? Mention some types of sequences?

Let G be a graph. For each of the following, determine if the statement is true...

Let G be a graph. For each of the following, determine if the statement is true or false. If it's true, provide a proof and if it's false, provide a counterexample. (a) G has a cycle if and only if G has a circuit (b) G has a closed walk if and only if G has a circuit (c) G has an odd-lengthed cycle if and only if G has an odd-lengthed circuit (d) G has an odd-lengthed closed walk...

Question