Find sequences that satisfy the following or explain why no such sequence exists: a) A sequence...

Find sequences that satisfy the following or explain why no such sequence exists:

a) A sequence with subsequences converging to 1, 2, and 3.

b) A sequence that is bounded above, but has no convergent subsequence.

c) A sequence that has a convergent subsequence but is unbounded (note: unbounded
means not bounded below or not bounded above.

d) A sequence that is monotonic and bounded, but does not converge.

Expert Solution

Colby Messinger answered 2 years ago

For each of the following degree sequences, determine if the exists a graph whose degree sequence...

For each of the following degree sequences, determine if the exists a graph whose degree sequence is the one specified. In each case, either draw a graph or explain why no such graph exists. a. (5,4,3,2,1) b. (5,4,3,3,2,1) c. (5,5,4,3,2,1) Please show work - Discrete Mathematics - THANKS

For each of the following sequences find a functionansuch that the sequence is a1, a2, a3,...

For each of the following sequences find a functionansuch that the sequence is a1, a2, a3, . . .. You're looking for a closed form - in particular, your answer may NOT be a recurrence (it may not involveany otherai). Also, while in general it is acceptable to use a "by cases"/piecewise definition, for this task you must instead present a SINGLE function that works for all cases.(Hint: you may find it helpful to first look at the sequence of...

Which of the following pairs of mRNA sequences is translated to the same protein sequence ?...

Which of the following pairs of mRNA sequences is translated to the same protein sequence ? Answer UUA UAU CGU CGG CUU UAC AGA AGG Using UCSC genome browser, find out the name of the human gene which is located within the genomic region chr21:38,785,658-38,844,604 of hg38 human genome version ? Answer: ETS2 I know the answer but I dont know how to solve them can you show me how to solve them please step by step its for bioinformatics

Question 1 - Infinite Sequences. (a). Determine an infinite sequence that satisfies the following . ....

Question 1 - Infinite Sequences. (a). Determine an infinite sequence that satisfies the following . . . (i) An infinite sequence that is bounded below, decreasing, and convergent (ii) An infinite sequence that is bounded above and divergent (iii) An infinite sequence that is monotonic and converges to 1 as n → ∞ (iv) An infinite sequence that is neither increasing nor decreasing and converges to 0 as n → ∞ (b). Given the recurrence relation an = an−1 +...

In sequences and series what is a sequence and what is a series? Mention some types of sequences?

Find a pair of vectors, a → and b → that satisfy all of the following...

Find a pair of vectors, a → and b → that satisfy all of the following conditions: a → + b → = 〈 9 , 5 , 5 〉 a → is parallel to 〈 5 , 1 , 2 〉 b → is orthogonal (perpendicular) to {5,1,2}

Find a closed formula for each of the following sequences. Show all work and explain your...

Find a closed formula for each of the following sequences. Show all work and explain your answers. (a) {1, 6, 17, 34, 57, 86, 121, . . .}, where a0 = 1. (b) an = 5an−1 + 4, a0 = 2 (c) an = 10an−1 − 21an−2, a0 = 6, a1 = 26.

6. The following sequences are mutations of the template sequence in question 1. For each mutated...

6. The following sequences are mutations of the template sequence in question 1. For each mutated sequence, indicate the new amino acid sequence produced and the type of mutation that is the end result in the amino acid (frameshift, Missense, nonsense, silent) as well as the type of mutation that occurred in the DNA sequence (substitution, addition, deletion) Template sequence question 1: 3’ TACCCTGGTGGTTTGCGGACT 5’ a. 3’ TAC CCG GTG GTT TGC GGACT 5’ b. 3’ TAC ACT GGTGGTTTGCGGACT 5’...

Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA...

Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underline these in the sequence) Predict the mRNA sequence that would arise from this DNA sequence. Identify the ribosome binding site, start and stop codons (if present). (Highlight/Underline these in the sequence). Predict the sequence of the peptide that would arise from the predicted mRNA sequence using the genetic code table (see Codon usage table). Based on your knowledge of the properties of...

What is the mRNA sequence of the following original DNA sequences? a) TAC b) GAG c)...

What is the mRNA sequence of the following original DNA sequences? a) TAC b) GAG c) CAT d) AAA e) GCC f) TTC g) CCG h) TGT

Question