5. How could you take a protein with a known sequence of amino acids and use...

5. How could you take a protein with a known sequence of amino acids and use it to make an artificial gene?

Expert Solution

(please do like thank you....)

gladiator answered 1 year ago

1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’...

1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ 2) Design a set of 6 base pair long primers that scientists could use to amplify the entire sequence of the gene in Q1 3) T/F. A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Q1.

What is the maximum number of amino acids that could result from the following mRNA sequence?...

What is the maximum number of amino acids that could result from the following mRNA sequence? 5′ AUGAGACCGUCG 3′ A. 0 B. 4 C. 7 D. 10

A large protein of 1205 amino acids was produced errors of average 8 mistakes/200 amino acids....

A large protein of 1205 amino acids was produced errors of average 8 mistakes/200 amino acids. Calculate probability to produce protein with: No mutation Less than 2 mutations Exactly 3 mutations Give mathematical expression and the number used in these expressions.

What do you think your 93rd amino acid is for this protein? the amino acid sequence...

What do you think your 93rd amino acid is for this protein? the amino acid sequence of the protein coded for by the wild-type TYRP1 is just below.

You are provided with the amino acid sequence of an important human protein that is suspected...

You are provided with the amino acid sequence of an important human protein that is suspected to be membrane protein. How can you analyze the amino acid sequence to try to find out more information on the transmembrane nature of this protein and the region of the protein that is likely to be in the membrane?

You are studying a gene that encodes a particular protein; part of the amino acid sequence...

You are studying a gene that encodes a particular protein; part of the amino acid sequence of that protein is shown below: …-His-Val-Pro-Thr-Asp-Leu-Glu-… You isolate a mutant version of this protein; the mutation abolishes the function of the protein. When you sequence the mutant protein, you see the following amino acid sequence: …-His-Val-Leu-Asp-Arg-Leu-Gly-… Answer/do the following (refer to the Codon Chart below): a. What was the most likely type of mutation (missense, nonsense, or frameshift) that occurred in the...

What is an amino acid? How many amino acids are there?

suggest how a protein might have been hydrolyzed to give the amino acids. keep in mind...

suggest how a protein might have been hydrolyzed to give the amino acids. keep in mind that this is made from human consumption.

A gene is composed of DNA and a protein is composed amino acids. Describe the steps...

A gene is composed of DNA and a protein is composed amino acids. Describe the steps involved in converting the information contained in a gene into a protein. **Please include and define all of the following terms in your description:** Ribosome, template strand, non-template strand, reading frame, complementary, tRNA, mRNA, start codon, stop codon, transcription factors, 5’ to 3’, translation, transcription, gene promoter, RNA polymerase

Common proteins are polymers of 20 different amino acids. How many amino acids are necessary for...

Common proteins are polymers of 20 different amino acids. How many amino acids are necessary for a protein polymer to have at least as many possible different sequences as there are atoms in the Universe? (There are about 2 × 1056 moles of atoms in the Universe.) *Note - The answer is a mathmatical answer. I need an explanation of the math behind this problem.

Question