Question

In: Biology

You are studying a gene that encodes a particular protein; part of the amino acid sequence...

You are studying a gene that encodes a particular protein; part of the amino acid sequence of that protein is shown below:

…-His-Val-Pro-Thr-Asp-Leu-Glu-…

You isolate a mutant version of this protein; the mutation abolishes the function of the protein. When you sequence the mutant protein,

you see the following amino acid sequence:

  

…-His-Val-Leu-Asp-Arg-Leu-Gly-…

Answer/do the following (refer to the Codon Chart below):

a. What was the most likely type of mutation (missense, nonsense, or frameshift) that occurred in the gene
encoding this protein that resulted in the mutated amino acid sequence above? (I am looking for the
simplest, most plausible explanation.)

b. In which codon did the mutation occur? What change actually happened?

c. Write out plausible RNA sequences that encode both the wild-type and mutant proteins

Solutions

Expert Solution

a. Answer- It is the frameshift type of point mutation where from the site of mutation, whole sequence of codon changes. As codon sequence changes, protein sequence also changed. In this example, after valine amino acid, whole sequence of protein changed. So that we can say that frameshift mutation occurred in the codon of proline.

b. Answer- in the codon of proline mutation occurred as from proline all further sequence of amino acid is changed.

Actually addition mutation has occurred at at the second nucleotide in proline codon. Proline is coded by 4 codons and each codon starts with CC and leucine is coded by 6 codons, out of 6 codons, 4 codons starts with CU as first two nucleotide. So that addition of U nucleotide between first and second nucleotide in proline codon CCU becomes CUC and as frame shift occurs, the last nucleotide of proline codon acts as first nucleotide for next codon. Next amino acid in normal polypeptide is threonine and it is coded by 4 codons and all starts with AC. So that G of proline acts as first nucleotide in threonine codon after addition mutation and new codon of proline becomes, CUC which codes for leucine.

c. Answer-

RNA sequence of wild type may be- • is site of addition mutation

....-CAU - GUA - C•CG - ACA - GAC - UUG - GAG-......

Sequence of wild type protein is-

....- His - Val - Pro - Thr - Asp - Leu - Glu -........

sequence of mutant RNA may be-

....-CAU - GUA - CUC - GAC - AGA - CUU - GGA - G-......

Sequence of mutant protein is-

....- His - Val - Leu - Asp - Arg - Leu - Gly -......


Related Solutions

Below is the sequence for the SARS-CoV-2 spike protein that encodes a 1757 amino acid protein...
Below is the sequence for the SARS-CoV-2 spike protein that encodes a 1757 amino acid protein capable of binding surface receptors on some cell types. The nucleotide sequence is from base pair 21,563 to 25,384 in the viral genome (numbers in left-most column). Upon binding, the virus is uptaken into the cell, the coat is shed, and viral RNA released into the cytoplasm. When this occurs, host cell ribosomes begin transcription and translation of the RNA, including this protein. In...
What do you think your 93rd amino acid is for this protein? the amino acid sequence...
What do you think your 93rd amino acid is for this protein? the amino acid sequence of the protein coded for by the wild-type TYRP1 is just below.
You are provided with the amino acid sequence of an important human protein that is suspected...
You are provided with the amino acid sequence of an important human protein that is suspected to be membrane protein. How can you analyze the amino acid sequence to try to find out more information on the transmembrane nature of this protein and the region of the protein that is likely to be in the membrane?
what are the consequences for the protein that the gene encodes?
what are the consequences for the protein that the gene encodes?
List the sequence of structures that a single amino acid (initially in a protein molecule that...
List the sequence of structures that a single amino acid (initially in a protein molecule that you eat) goes through from the moment it passes your lips to when it ends up in a hepatocyte. Then explain what (if any) chemicals relevant to digestive physiology it is exposed to at each step and what happens to the protein and eventually protein fragments each step of the way.
Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’...
Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ How many amino acids long is the protein? Part B: A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Part A. True/False
Describe the effect of a mutation in the gene that encodes for the C3 protein of...
Describe the effect of a mutation in the gene that encodes for the C3 protein of the complement pathway.
The hunchback gene contains a promoter region, the structural region (the amino acid coding sequence), and...
The hunchback gene contains a promoter region, the structural region (the amino acid coding sequence), and a 3' untranslated region (DNA that will be transcribed into sequences appearing at the 3' end of the mRNA that are not translated into amino acids). a. What important sequences required to control hunchback gene expression are found in the promoter region of hunchback? b. What sequence elements that encode specific protein domains are found in the structural region of hunchback? c. There is...
In studying a particular bio-molecule (a protein, nucleic acid, carbohydrate, or lipid) in the laboratory, the...
In studying a particular bio-molecule (a protein, nucleic acid, carbohydrate, or lipid) in the laboratory, the biochemist first needs to separate it from other biomolecules in the sample—that is, to purify it. Specific puri-fication techniques are described later in the book. However, by looking at the monomeric subunits of a biomolecule, you should have some ideas about the characteristics of the mole-cule that would allow you to separate it from other molecules. For example, how would you separate (a) amino...
Endorphin is a fully functional protein however its amino acid sequence is much shorter than the...
Endorphin is a fully functional protein however its amino acid sequence is much shorter than the coding region of the DNA and shorter than the mature mRNA sequence. Explain why. Give three other examples of post-translational modifications that might affect the activity of endorphin.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT