What is an amino acid? How many amino acids are there?

Expert Solution

Aminoacids are organic, structural monomer units and are building blocks of proteins through peptide bonds.

There are 20 standard and naturally occurring aminoacids.

(in nature, total 22, in Eukaryotes and humans 21 aminoacids)

-------------

Aminoacids are organic nutrients that appear in foods and in the human body either as building blocks of proteins or as free amino acids.

Amino acids are made of the amino group (NH2), carboxyl group (COOH) and a side chain containing carbon, hydrogen or oxygen; two amino acids (cysteine and methionine) also contain sulfur and one (selenocysteine) contains selenium.

It is the R-group or side chain that differs between the 20 amino acids.

Amino acids are the structural units (monomers) that make up proteins. They join together to form short polymer chains called peptides or longer chains called either polypeptides or proteins. These polymers are linear and unbranched, with each amino acid within the chain attached to two neighboring amino acids.

Amino–Acid–Name–with (Abbreviation)	Classification
1. Histidine (His) 2. Isoleucine (Ile) 3. Leucine (Leu) 4. Lysine (Lys) 5. Methionine (Met) 6. Phenylalanine (Phe) 7. Threonine (Thr) 8. Tryptophan (Trp) 9. Valine (Val)	ESSENTIAL Amino Acids The 9 amino acids on the right are essential (vital), which means they are necessary for the human life and health but cannot be produced in your body so you need to get them from foods.
10. Arginine (Arg) 11. Cysteine (Cys) 12. Glutamine (Gln) 13. Glycine (Gly) 14. Proline (Pro) 15. Serine (Ser) 16. Tyrosine (Tyr)	CONDITIONALLY ESSENTIAL Amino Acids These amino acids can be synthesized in your body, but in certain circumstances, like young age, illness or hard exercise, you need to get them in additional amounts from foods to meet the body requirements for them. Ornithine is also considered conditionally essential amino acid, but it does not form proteins .
17. Alanine (Ala) 18. Asparagine (Asn) 19. Aspartic acid (Asp) 20. Glutamic acid (Glu) 21. Selenocysteine	NONESSENTIAL Amino Acids These amino acids can be synthesized in your body from other amino acids, glucose and fatty acids, so you do not need to get them from foods.

Twenty-two amino acids are naturally incorporated into polypeptides and are called proteinogenic or natural amino acids. Of these, 20 are encoded by the universal genetic code. The remaining 2, selenocysteine and pyrrolysine, are incorporated into proteins by unique synthetic mechanisms.
In eukaryotes, including humans, there are only 21proteinogenic amino acids, the 20 of the standard genetic code, plus selenocysteine.

gladiator answered 1 year ago

Common proteins are polymers of 20 different amino acids. How many amino acids are necessary for...

Common proteins are polymers of 20 different amino acids. How many amino acids are necessary for a protein polymer to have at least as many possible different sequences as there are atoms in the Universe? (There are about 2 × 1056 moles of atoms in the Universe.) *Note - The answer is a mathmatical answer. I need an explanation of the math behind this problem.

translation: Genetic code; codon. How many codons are there? How many code for amino acids? What...

translation: Genetic code; codon. How many codons are there? How many code for amino acids? What do the others do? What is the genetic code? tRNA; anticodon; aminoacyl-tRNA synthetase. What key role do aminoacyl-tRNA synthetases play in translation? Why is there more than one? Ribosome structure. What are ribosomes made of? Where are they made? Why are there 3 tRNA binding sites? Translation initiation complex Why wouldn't a transcribed mRNA not be translated immediately? Elongation & translocation in translation. In...

\Match the following descriptions with the corresponding amino acids: This amino acid is responsible for the...

\Match the following descriptions with the corresponding amino acids: This amino acid is responsible for the strength of rhino horns and wood lignin due to the strong hydrophobic interactions between them. Subtle decreases in the serum pH lead to the protonation of this amino acid, which promotes O2 release from hemoglobin. This amino acid is the nucleophile chymotrypsin uses to attack peptide bonds. This amino acid disrupts α-helices because it makes the nearby protein backbone too flexible (and prevents proper...

Two amino acids are either not a standard alpha- amino acid or in the S configuration....

Two amino acids are either not a standard alpha- amino acid or in the S configuration. Which residues are they, and how are they different? Illustrate your reasoning with chemical structures

If a polypeptide is composed of 319 amino acids, how many nucleotides were in the mRNA...

If a polypeptide is composed of 319 amino acids, how many nucleotides were in the mRNA transcript for the polypeptide? Show your work (math).

Perhaps the most central concept in amino acid degradation is that some amino acids are glucogenic,...

Perhaps the most central concept in amino acid degradation is that some amino acids are glucogenic, some are ketogenic and some are both glucogenic and ketogenic. Which of the following amino acids is both glucogenic and ketogenic? A. Arg B. Ile C. Leu D. Asn E. Cys

1.How do D -amino acids differ from L-amino acids? What biological roles are played by peptides...

1.How do D -amino acids differ from L-amino acids? What biological roles are played by peptides that contain D -amino acids? 2.Which amino acid is technically not an amino acid? Which amino acid contains no chiral carbon atoms? 3.For each of the following, name an amino acid in which the R group contains it: a hydroxyl group, a sulfur atom, a second chiral carbon atom, an amino group, an amide group, an acid group, an aromatic ring, and a branched...

1)What are amino acids? Amino group, carboxyl end, what is the side chain of an amino...

1)What are amino acids? Amino group, carboxyl end, what is the side chain of an amino acid? 2)What are essential and non-essential amino acid. 3)Which are the essential amino acids? 4)Classify the amino acids based on polarity of the R group:

The 21st and 22nd amino acids found in proteins are the rare amino acids ______________ and...

The 21st and 22nd amino acids found in proteins are the rare amino acids ______________ and ______________. ________________ are nonviral genetic elements that have reverse transcriptase activity. An example of retrotransposons in the human genome is the ____ family of sequences.

1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’...

1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ 2) Design a set of 6 base pair long primers that scientists could use to amplify the entire sequence of the gene in Q1 3) T/F. A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Q1.

Question