1. List all the chemical bonds and interactions. Give at least one example for each. Make...

1. List all the chemical bonds and interactions. Give at least one example for each. Make sure to include a biological molecule in the examples. Draw four molecules which shows polar and nonpolar covalent bond, H-bond and ionic bond.

Expert Solution

(i) Polar covalent bond: The biological molecule that has the polar covalent bond is D-glucose, where all the O-H bonds show polar covalent bonds.

In fact, all the compounds that have O-H and N-H bonds will be considered as examples of polar covalent bonds.

(ii) Nonpolar covalent bond: The biological molecule that has the nonpolar covalent bond is D-mannose, where all the C-C bonds show nonpolar covalent bonds.

In fact, all the compounds that have C-C bonds will be considered as examples of nonpolar covalent bonds.

(iii) H-bond: The biological molecules that show the intermolecular hydrogen bonds (double) are Adenine (A) and Thiamine (T). The biological molecules show the intermolecular hydrogen bonds (triple) are Guanine (A) and Cytosine (T).

(iv) Ionic bond: The biological molecule that shows the ionic bond is lactic acid, where the carboxylic acid, C(=O)O-H group show the ionic bond.

queen_honey_blossom answered 2 years ago

List, describe and give at least one example of each of the three types of taxes...

List, describe and give at least one example of each of the three types of taxes that we pay. And answer: Which do you think are fair or unfair and why?

List at least one chemical reaction if possible of Melatonin.

Explain and give at least one example of each of the following major themes (or strategies)...

Explain and give at least one example of each of the following major themes (or strategies) in the control of RNA virus gene expression: linkage between replication and control of expression, multifunctional gene products, overlapping genes, use of secondary structure to control gene expression, leaky termination, use of host proteins for viral functions, mimicking host cap structure, subgenomic mRNA, regulatory protein.

1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions....

1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions. 2. You want to amplify at least the underlined sequence, you can have some flanking sequence as well. 5’CTGCTACGTACTGGATGACTGACTGTGATGATCTGATCCCAGTGCTCGTAGTCGTGCGTTCGTAATATATAGCGATGGCGCGATGCGATGCGCGTAGCGGCTAGGCGTAGGCGGATTCGGCTAGGCGATGGCGATGGCGATGCGATATTCTAGCGCTAGCGATGAGGTGATTATATCGGCGCTAGCTGATCGTAGCTGATCG 3’ Design the most optimal primers according to Tm and length. Write out each primer and show which is the 5’ and 3’ end of each primer. How big will your PCR product be? 3.. What are the differences between covalent bonds and non-covalent...

Give at least one example of a firm that operates in each market structure: perfect competition...

Give at least one example of a firm that operates in each market structure: perfect competition monopolistic competition oligopoly monopoly Explain briefly the reasons for your selections (relate to 4 major criteria for the classification of market structures). You may offer an example of the specific firm or the type of a firm (for example "Microsoft" or just a "software maker").

1. List the levels of anxiety and give an example of each. What is the primary...

1. List the levels of anxiety and give an example of each. What is the primary goal of anxiety? Are most Benzodiazepine and antidepressant drugs effective in treating anxiety? Explain. Why would you use an antidepressant medication to help someone with anxiety? When working with a person who has anxiety what are some of the factors the nurse needs to assess. What are some of the risk factors to identify when assessing a patient with anxiety. Can you identify any...

For your main Discussion post, list at least one of each transaction related to all of...

For your main Discussion post, list at least one of each transaction related to all of the following business events: Purchase of goods or services for cash Providing services for cash Providing services on account Purchase of goods or services on account Payment of a previously recorded expense Receipt of a previously recorded revenue earned Be sure to explain your logic in the analysis of your business transactions and do not repeat examples from the textbook. Also, list the type...

There are many sources of motivation. Describe all four and give an example of each one.

Explain pharmacokinetic interactionsunder ADME. Give an example to each oneand mention the outcome of these interactions....

Explain pharmacokinetic interactionsunder ADME. Give an example to each oneand mention the outcome of these interactions. can anyone write long ?

what are the biotic interactions that occur between species? Give and example of each biotoc interaction....

what are the biotic interactions that occur between species? Give and example of each biotoc interaction. How would organisms adapt to these interactions over time (in other words what would you expect to see in the future between these organisms)?

Question