Question

In: Psychology

1. List at least three examples that fit the definition of aggression, and at least one...

1. List at least three examples that fit the definition of aggression, and at least one that does not.  (Examples can be hypothetical or real)

2. Why do people deny the harmful effects of violent media when the research evidence linking violent media to aggression is so conclusive?

3. Consider the various causes of aggression described in this module and elsewhere, and discuss whether they can be changed to reduce aggression, and if so how

Solutions

Expert Solution

Aggression refers to the range of behaviour that can result in both physical and psychological harm done to yourself, others, object or environment. For eg: 1) The child throwing tantrums, because child's demands are ot fulfilled, he would show aggreesive behaviour shout and cry and would be hostile. 2) Husband and wife showing agressive behavior, let us say psychological aggressiveness such as not talking with each other, not considering each other, not saying kind words even if required. 3) The freedom fight sought by the freesom fighters can not be aggression, they want their own freedom, they want to rule their own country, it their right. Hence people fighting for their own land and displaying strikes etc can not be aggression, they are fighting against injustice done.

2. People like such content, it is often the defense mechanism used of Denial. Hence even at their back of the mind they know that voilent content is harmful for their mind but they would refuse. They have become addicted to such content.

3. There many factors of agression such as it can be heridatory, there are environmental factors as well such as people around, the work place, the family problems etc. Some physical factors such as epilepsy, brain injury or abnormalities also lead to aggression. Aggression can be reduced if one decides to reduce it , one can channelize the agresion such by taking into forms of some studies or by writing. Writing a diary also helps in reducing aggression, listening to music can be a therapy, or in case of hyper aggressive people dance therapy or gyming, zumba can be effectives ways to reduce aggression. Similarly meditation, doing yoga can help is reducing aggression. If any family member is aggressive then listening to what he or she says, understanding their behaviour, helping him or her to do things would help in reducing aggression.


Related Solutions

list three principles of economics for UBER with examples on each one
list three principles of economics for UBER with examples on each one
1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions....
1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions. 2. You want to amplify at least the underlined sequence, you can have some flanking sequence as well.       5’CTGCTACGTACTGGATGACTGACTGTGATGATCTGATCCCAGTGCTCGTAGTCGTGCGTTCGTAATATATAGCGATGGCGCGATGCGATGCGCGTAGCGGCTAGGCGTAGGCGGATTCGGCTAGGCGATGGCGATGGCGATGCGATATTCTAGCGCTAGCGATGAGGTGATTATATCGGCGCTAGCTGATCGTAGCTGATCG 3’ Design the most optimal primers according to Tm and length. Write out each primer and show which is the 5’ and 3’ end of each primer. How big will your PCR product be? 3.. What are the differences between covalent bonds and non-covalent...
List at least three specific professional objectives for yourself at the one-, three-, and five-year marks...
List at least three specific professional objectives for yourself at the one-, three-, and five-year marks after you graduate from college, which are key points in your career. Include your targeted industry, graduate school program (if applicable), level of employment (manager, director, etc.), and expected salary and benefits at each year. Then make specific contingency plans for each time period if you have not reached the objectives listed. Finally, write a one-paragraph description of how potential developments in your personal...
List, describe and give at least one example of each of the three types of taxes...
List, describe and give at least one example of each of the three types of taxes that we pay. And answer: Which do you think are fair or unfair and why?
List at least three surface imaging techniques, and describe advantage and disadvantage of each one.
List at least three surface imaging techniques, and describe advantage and disadvantage of each one.
A comprehensive Introduction of cosmetology. At least 10 examples of cosmetic preparations having description as Definition...
A comprehensive Introduction of cosmetology. At least 10 examples of cosmetic preparations having description as Definition Composition Method of preparation Uses /application
List three examples of a money market instrument.
List three examples of a money market instrument.
1 a) List at least one (1) substitute for your product. Briefly (1 – 3 sentences)...
1 a) List at least one (1) substitute for your product. Briefly (1 – 3 sentences) describe how the benefits of the substitute product are similar but not exactly the same as your product. What is the relative power of substitutes in the market?  In other words, is it relatively easy or hard for customers to migrate to a substitute market including going without or making the product oneself? b) What does the market demand curve look like?  How would you describe...
1. Give two examples of cash receipts and two examples of cash payments that fit into...
1. Give two examples of cash receipts and two examples of cash payments that fit into each of the following classifications: a. Operating activities. b. Investing activities. c. Financing activities. 2. Why are payments and receipts of interest classified as operating activities rather than as financing or investing activities?
1.What is the impact that supply and demand have on pricing? Provide at least three examples...
1.What is the impact that supply and demand have on pricing? Provide at least three examples from your experience?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT