What type of interactions are important and prevalent in biological systems? Non-covalent or Covalent? Please explain...

What type of interactions are important and prevalent in biological systems? Non-covalent or Covalent? Please explain your choice. Can you provide examples of both these types of interactions in the context of protein structure that you learned.

Solutions

Expert Solution

In biological systems, both covalent as well as non-covalent interactions are prevalent. All the basic structural components of biomolecules have different types of interactions, some are involved in making of these biomolecules (like covalent interactions within and between monomeric units in Proteins, Nucliec acids, carbohydrates etc), while others are involved in stabilizng and giving a proper three-dimensional structures to add functional compexities.

As far as proteins are concerned, the primary structure has covalent interactions as within the aminoacids (in the form of C-C, C=O, C-H bonds) and between the aminoacids (in the form of peptide bonds). However the secondary structures like alpha-helices and Beta sheets are held together by intramolecular hydrogen bonds. Similiarly the tertiarry or quarternary 3-D structures involves other non-covalent interactions like electrostatic interactions, hydrophobic interactions and vanderwaal's interaction between the side chains of aminoacids belonging to same or different polypeptides.

gladiator answered 1 year ago

Next > < Previous

Related Solutions

1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions....

1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions. 2. You want to amplify at least the underlined sequence, you can have some flanking sequence as well. 5’CTGCTACGTACTGGATGACTGACTGTGATGATCTGATCCCAGTGCTCGTAGTCGTGCGTTCGTAATATATAGCGATGGCGCGATGCGATGCGCGTAGCGGCTAGGCGTAGGCGGATTCGGCTAGGCGATGGCGATGGCGATGCGATATTCTAGCGCTAGCGATGAGGTGATTATATCGGCGCTAGCTGATCGTAGCTGATCG 3’ Design the most optimal primers according to Tm and length. Write out each primer and show which is the 5’ and 3’ end of each primer. How big will your PCR product be? 3.. What are the differences between covalent bonds and non-covalent...

Using your knowledge of the main types of non-covalent interactions that occur in biological chemistry, discuss...

Using your knowledge of the main types of non-covalent interactions that occur in biological chemistry, discuss the spontaneous assembly of the four main types of biological structure with stable structures: DNA, proteins, glycans (such as cellulose and chitin) and cell membranes. Compare and contrast the various structures in terms of the forces and chemical structures driving their assembly. Finally, discuss why their particular molecular structures allow them to perform their biological roles.

describe the chemical nature of the non-covalent bonding interactions between peptides and lipids.

1. What non-covalent interactions can (1) Alanine and (2) Threonine acid participate in, as part of...

1. What non-covalent interactions can (1) Alanine and (2) Threonine acid participate in, as part of tertiary structure at pH 7? Include an explanation of the charges involved (full or partial, permanent or temporary)? 2. Suggest one amino acid whose side chain can participate in a non-covalent interaction with the side chain of alanine, and one amino acid whose side chain can participate in a non-covalent interaction with the side chain of threonine.

In the following diagram, solid lines represent covalent bonds while dotted lines represent non-covalent interactions. Which...

In the following diagram, solid lines represent covalent bonds while dotted lines represent non-covalent interactions. Which of the depictions of molecules show a hydrogen bonding interaction. Check all systems that apply. Consult Textbook Your Answers: H—H —N‧‧‧‧‧H—O— —C‧‧‧‧‧H—F— —O‧‧‧‧‧H—C— Submit Feedback: Question 14 Identify which of the following molecules have a net dipole moment: Consult Textbook Your Answers: CCl4 CH2Cl2 (CH3)2O CO2 BF3 Submit Feedback: Question 15 Determine the predominant intermolecular force in each of the following substances: Consult Textbook...

Name and thoroughly discuss the 4 non-covalent interactions that are responsible for stabilizing the secondary structures...

Name and thoroughly discuss the 4 non-covalent interactions that are responsible for stabilizing the secondary structures of proteins?

What are trophic cascades and how do they explain connected biological systems?

1. Which type of chain growth polymer is obtained in nature? Please explain the biological pathway...

1. Which type of chain growth polymer is obtained in nature? Please explain the biological pathway 2. How can you obtain penicillin? (Hint… please consider bioprocessing-fermentation etc

What are the biological interactions that occur during the "fight or flight" reflex. In general, how...

What are the biological interactions that occur during the "fight or flight" reflex. In general, how do neurotransmitters and neurohormones play a role in communication between the CNS and the ENS? How do the endocrine and nervous systems work together in times of an emergency. Explain the biological changes and signs that occur during Walter Cannon's arousal reflex (the fight or flight reflex) and Selye's General Adaptation Syndrome – including the concept of reactivity.

What makes a nucleus unstable? What type of interactions is there in the nucleus?

Subjects