Question

In: Biology

Q. Identify and explain how the system of a single cell is supposed to function in...

Q. Identify and explain how the system of a single cell is supposed to function in a normal environment and is being affected by the item listed below. This means explaining how all aspects of the cell (inside and outside) may be impacted by this problem.

-Make sure to fully explain the item listed in the cellular dysfunction as well as all other related items in the system of a cell.

1. Inherited Autosomal Recessive Mutation of hydrolytic enzymes (inherited at the organismal level, but impacts the single cell found in a tissue)

1a. Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA

1b. Mutated portion of gene: ATGCCGCGCCCGCCGTTAGGCATGCGCA

Solutions

Expert Solution

Every single cell, in a given appropriate environment has to perform functions of Transportation, Reproduction and Metabolism. This is irrespective of the cell being a unicellular organism or a cell that is a part of a tissue, with an assigned function.

Transportation involves transfer of ions and other molecules in and out of the cell. Reproduction is where the genetic material is transmitted from one generation to another, for new cells to form, either by mitosis or meiosis. Metabolism refers to all the chemical reaction that takes place inside the cell pertaining to breaking or making of a biomolecule and also deriving or trapping energy in the process.

An inherited autosomal recessive mutation of hydrolytic enzyme when encountered, the cell undergoes tremendous changes. Firstly, hydrolytic enzymes or hydrolases are enzymes that are required to bring about catalytic reactions to breakdown larger molecules to smaller, and is a large group of enzymes including proteases, lipases, amylases, nucleases, etc. If mutation (deletion, insertion as in this case) occurs is any of these enzymes, it will result in reduced or eliminted catalytic activity of the respective enzyme. The result would be accumulation of their substrate. The prolonged accumulation of molecules may then lead to a diseased state, as is seen in lysosomal storage disease.

Since it is an autosomal recessive mutation, unless it is present on both alleles, the mutation will not be evident. When present, it will mostly change the phenotypic appearance of the cell depending of which function is impaired. In the given case, increases GC content (higher than normal - increased by 6%) may also reduce longevity of the cell.


Related Solutions

Explain briefly how oligosaccharides function as cell markers.
Explain briefly how oligosaccharides function as cell markers.
A single firm produces widgets, with a cost function and inverse demand function as follows, C(q)...
A single firm produces widgets, with a cost function and inverse demand function as follows, C(q) = 150+2q P(Qd) = 10−0.08Qd (a) Calculate the monopolist’s profit-maximizing price, quantity, and profit if he can charge a single price in the market (single price monopolist). (b) Suppose the firm wants sell units after your answer to (a) at a lower price in a later time period (2nd-degree price discrimination). What quantity will be sold for what price in this second-tier market? Calculate...
19. What is the cell cycle control system? How does it function? What can happen if...
19. What is the cell cycle control system? How does it function? What can happen if this system malfunctions?
Explain what cells do (identify the role of an example cell, tissue, organ, system) Classify cells...
Explain what cells do (identify the role of an example cell, tissue, organ, system) Classify cells based on their functions, size and shapes; Sketch a cell, with key structural and functional specialisations noted; Provide representative exemplar cells of the nervous and endocrine systems and relate their functional role to their morphological and subcellular specialisations; Describe the structure and function of cell components and organelles; e.g. the cell membrane, cytoskeleton, the nucleus, mitochondria, endoplasmic reticulum, Golgi complex, ribosomes, etc.; Define and...
3. How is the purchasing and receiving function supposed to work for the Food and Beverage...
3. How is the purchasing and receiving function supposed to work for the Food and Beverage category – i.e., how is it designed to operate? What steps are different from the other categories? Again, a process flow map is helpful along with a specific example of something they might buy (i.e., salmon from Alaska or oranges from CA). Be sure to include the relationship with Safeway and how that works.
Explain why there is the optimized bandgap for single-junction photovoltaic cell, in which the cell efficiency...
Explain why there is the optimized bandgap for single-junction photovoltaic cell, in which the cell efficiency initially increases as a function of bandgap, reaches a peak at certain value of bandgap, and then decreases as bandgap further increases. Explain difference between superstrate and substrate configuration in thin-film photovoltaic cells.
Match the reproductive system cell with its description or function Haploid female gamete Germ cell that...
Match the reproductive system cell with its description or function Haploid female gamete Germ cell that can produce oocytes Germ line stem cell that can produce spermatozooa Maternal cells that form the corona radiata surrounding the egg Cells that release cytokines that promote spermatogenesis Mature male gamete Smaller cellular progeny of meiosis in female mammals Anterior pituitary cell that produces LH and FSH Diploid precursor of egg and polar bodies Cells that synthesize testosterone in the testes Immature spermatozoon that...
1. Suppose that output q is a function of a single input, labor (L). Describe the...
1. Suppose that output q is a function of a single input, labor (L). Describe the returns to scale associated with each of the following production functions: a. q = 3L. Answer: b. q = L3. Answer:
An economist estimated that the cost function of a single-product firm is: C(Q) = 70 +...
An economist estimated that the cost function of a single-product firm is: C(Q) = 70 + 25Q + 20Q2 + 10Q3. Based on this information, determine the following: I can't figure G out? . The fixed cost of producing 10 units of output. $ 70 b. The variable cost of producing 10 units of output. $ 12,250 c. The total cost of producing 10 units of output. $ 12,320 d. The average fixed cost of producing 10 units of output....
A firm uses a single input to produce a good according to the production function q...
A firm uses a single input to produce a good according to the production function q = f(x) = 4x(1/2), where x is the input. The good sells for $4 per unit, and the cost of input x is w. a. Create a function showing the firm’s profit as a function of x and w. b. Find the profit maximizing amount of x as a function of w. What is the profit maximizing amount of output? c. Will this firm...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT