Transcribe the following sentences "HEART: regular rate and rhythm." "Stool culture was positive for E. coli."...

Transcribe the following sentences

"HEART: regular rate and rhythm."

"Stool culture was positive for E. coli."

"Lungs: clear to auscultation and percussion."

Expert Solution

Nightingale answered 2 years ago

3. Describe a method to isolate E. coli mutants that do not transcribe lacZ?

A grad student has a culture of E. coli with a total volume of 600 mL,...

A grad student has a culture of E. coli with a total volume of 600 mL, and OD reading at 550 nm of 1.7. He makes serial dilutions of the culture, starting with a transfer of 1 mL culture into 9 mL tryptone broth. Next, he transfers 0.1 mL of this dilution into 0.9 mL tryptone broth, and repeats this two more times to make a total of 4 serial dilutions. He then pipets 200 uL from the fourth dilution...

1. The mixed culture in an experiment was prepared by mixing overnight E. coli and S....

1. The mixed culture in an experiment was prepared by mixing overnight E. coli and S. aureus cultures in the ratio 2:8. However, there seemed to be more E. coli growth on the resulting streak plate than S. aureus growth. Explain this. 2. It was observed that some colonies of the same bacterial species appeared in different sizes on the streak plates. Give the possible reason for this. 3. Is it better to prepare pure culture in broth or on...

You have an E. coli culture of which you are trying to determine the cell concentration....

You have an E. coli culture of which you are trying to determine the cell concentration. You need to perform a serial dilution. You take 100 µL of the undiluted stock culture, add it to 9.9 mL water in tube A, and mix. Then you take 100 µL of the material in tube A, add it to 9.9 mL water in tube B, and mix. Then you take 100 µL of the material in tube B, add it to 9.9...

Which of the following statements is TRUE? E. coli sigma factors all recognize one E. coli...

Which of the following statements is TRUE? E. coli sigma factors all recognize one E. coli gene Prokaryotic mRNAs contain sequences for sigma factor binding mRNA in both E. coli and humans are translated with the same translation machinery E. coli sigma factors all bind to the core RNA polymerase mRNA always contains the nucleotide sequence encoding just one protein

The rate at which the cell synthesizes RNA in E. coli is greatest for ________ RNA...

The rate at which the cell synthesizes RNA in E. coli is greatest for ________ RNA while the most abundant type of RNA is _________. Question options: a) messenger; ribosomal b) ribosomal; messenger c) transfer; ribosomal d) transfer; transfer e) None of the above Thank you so much for your help!

You have just synthesized a new antibiotic effective at preventing E. coli growth in agar culture....

You have just synthesized a new antibiotic effective at preventing E. coli growth in agar culture. Now speculate on the proposed mechanism for the newly synthesized antibiotic’s interaction with ATCase. Describe the two limiting possible mechanisms by indicating the involvement of specific subunits of ATCase: 1. Competitive inhibitor 2. Allosteric effector

Which of the following occurs as a result of an abundance of tryptophan in E. coli?

Which of the following occurs as a result of an abundance of tryptophan in E. coli? A.The leader sequence is not transcribed. B.The 5 trp genes (TrpA - TrpE) are not transcribed. C.Stalling of the ribosome at trp codons in the leader sequence D. The 5 trp genes (TrpA - TrpE) are transcribed, but not translated.

Which of the following is required for an insertion sequence element in E. coli to be...

Which of the following is required for an insertion sequence element in E. coli to be able to transpose? A gene for reverse transcriptase and long terminal repeats A gene for reverse transcriptase and inverted repeats A gene for transposase and inverted repeats A gene for transposase and long terminal repeats A gene for DNA polymerase and long terminal repeats Which type of deletions and/or insertion would not lead to frameshift mutations? A deletion that removes only a single amino...

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The...

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The strand is transcribed from left to right and codes for a small peptide. a) Is this the mRNA-like coding strand or template strand? b) Which end is the 3' end and which is the 5' end? c) What is the DNA coding strand sequence of the ORF ? d) What is the sequence of the entire transcript (assume the +1 of transcription begins at...

Question