Question

In: Statistics and Probability

DNA encodes proteins by reading the sequence in ordered triplets. For example, the three ordered triplets...

DNA encodes proteins by reading the sequence in ordered triplets. For example, the three ordered triplets in the ACCAGGTTA sequence are ACC, AGG, and TTA. That is, a different triplet can encode a different amino acid. How many different amino acids can be coded for each ordered triplet?

Solutions

Expert Solution

Answer :  

There are 20 amino acids possible to be encoded by all combinations of triplet or codons. Out of the possible 64 combinations of codons, 3 of them are stop codons which donot encode for any amini acid and 61 of them specify for different amino acids.

Each ordered triplet of nucleotides is also called as a codon. Every codon, except for the 3 stop codons encode for only a single amino acid which is unique. There are 20 amino acids which are encoded by a 64 combinations of codon or triplet nuclotides. So, an amino acid can be encoded by more than one codon and this is also the reason that the genetic code is said to be degenerate.

Example: A single codon or triplet encodes for only one amino acid i.e UUU encodes for phenyalanine amino acid always.

But, phenylalanine is also encoded by codon UUC. So, an amino acid can be encoded by more than one codon.


Let me know in the comment section if anything is not clear. I will reply ASAP!
If you like the answer, please give a thumbs-up. This will be quite encouraging for me.Thank-you!


Related Solutions

I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions....
I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 1 ATGAGGAGTT 11 GACACACAAG 21 AGGAGGTAGC 31 AGTATGGGTA 41 TAATCTAATG 51 CGTAATTGAG 61 GAGGTAGTTG 71 ACGTATGAAT 81 AGTTAACGTA 91 CGGGGGGGAA 101 ACCCCCCCTT 111 TTTTTTTTTC 121 GAGCAATAAA 131 AGGGTTACAG 141 ATTGCATGCT b) What region of this prokaryotic DNA sequence will be transcribed into mRNA? Circle one. 1-131 71-119 74-149 54-119 c) What will the sequence be for the protein translated from this mRNA? d) Where...
The DNA in a cell's nucleus encodes proteins that are eventually targeted to every membrane and compartment in the cell, as well as proteins that are targeted for secretion from the cell.
  The DNA in a cell's nucleus encodes proteins that are eventually targeted to every membrane and compartment in the cell, as well as proteins that are targeted for secretion from the cell.For example, consider these two proteins:1. Phosphofructokinase (PFK) is an enzyme that functions in the cytoplasm duringglycolysis.2. Insulin, a protein that regulates blood sugar levels, is secreted from specializedpancreatic cells.Assume that you can track the cellular locations of these two proteins from the time that translation is complete...
Examine the DNA sequence shown below. How many possible reading frames does this piece of DNA...
Examine the DNA sequence shown below. How many possible reading frames does this piece of DNA have? Explain where they are. Which one can be used and how do you know? 5'-AGTCGA TCGAACGGTCA TCG-3' 3'-TCAGCTAGCTTGCCAGTAGC-5' What feature of eukaryotes makes annotation more difficult? Describe the process whereby DNA is transferred from Agrobacterium to plants.
Using a DNA sequence as an example, illustrate and describe the listed mutations - deletion -...
Using a DNA sequence as an example, illustrate and describe the listed mutations - deletion - insertion - nonsense mutation - substitution - back mutation
A DNA sequence is. TACACCTTGGCGACGACT
A DNA sequence is. TACACCTTGGCGACGACT WHAT IS m RNA sequence is _______________________________ mutated sequence is TACACCTTGGGACGACT what is mRNA mutated. ____________________________________ What kind of mutation is this and what would be the result in terms of the amino acid sequence? (hint... use chart in notes
Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...
Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')
Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....
Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3'   T A C C G A T G G    5'
Compare to this DNA sequence: 1. Forward sequence: GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAG
Compare to this DNA sequence: 1. Forward sequence: GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTACCACACATCAACTGCAACTCCAAAGCCACCTCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGAAAACCCTTGACCAACCATCCTCCAGGGCCGAGGGTAATTTCTTTTGGTTTCATTCTAAAGGCACCATTGTGCGACTTTCTATTTGAACTCAAGGGCAGTTTCTTTATTCCTCTCCCTTTACTCTCGCATCCTTAAAGGAAAAGGAGGTTTCGAATTCCCCCCTGTCTAATTGTTAGAGCACACATAGGCGATCGTTCTATAACTCAGCACAAACCGGGGGGAAAAACATTTCATAGGGGCACTAAGTCTCGGATTCCCCATCTTCCCCCGGGGGCTGGGCGGGTAGCCCCTTGAAAACACTAGACCCTTCGGTGGTAAAAATTGCCTACAACCGAATTAAAAAATGAGAGCCGTTTTTCCTGGC Reverse sequence: ATTTTGAGGGGGCTTCTTGGGGGGCGAGTAGGATTGACTCGTGATGTGCTATGTACGGTAATGGCTTTATGTACTATGTACTGTTAAGGGTGGGTAGGTTTGTTGGTATCCTAGTGGGTGAGAGGTGGCTTTGGAGTTGCAGTTGATGTGTGGTAGTTGAGGGTTGATTGCTGTACTTGCTTGTAAGCATGGGGAGGGGGGTTTTGATGTTGGATTGGGTTTTTTATGTACTACAGGTGGTTAAGTATTTTATGGTACCGTGCAATTATTTCATGGGTGGCTGGGCAGTATTGTACGGAGATACCATAGCGGGTTGGTTGGATGGGGTAAAGTCATTAATTTGGGGTGGGTACCCCAAATCTGCTTCCCCCATGAAAAGAAACAGAGAATAAGTTTTAATTTTGGTTTCTTTAGCTTTGGGGTGCTTAATGGGGGGGAGGTTAAAAAACCCCCCCGCCGTTTCCCGGGGGGGGGGGGGGGGGCAACCTTCCCCGGGCCCGGGGGGAAAACTAACCCGTATGGACAGTCTTCCAATCACGTCAAAGTTTAGGTCTTTTTATATTACTTCAATGGGGCTGGGGGACGTTCGGGAAAACGGGTGACCCATTGGGGGGTTAATCACCTTGGGGGATAGTCCGGTGGGGGAGCTGGCCCAAGTGCCCAATATCAACGTGGTGACGGGGGGGTGGGGGGGGGGCGGTGGGGTCTCGAAA
You are studying a gene that encodes a particular protein; part of the amino acid sequence...
You are studying a gene that encodes a particular protein; part of the amino acid sequence of that protein is shown below: …-His-Val-Pro-Thr-Asp-Leu-Glu-… You isolate a mutant version of this protein; the mutation abolishes the function of the protein. When you sequence the mutant protein, you see the following amino acid sequence:    …-His-Val-Leu-Asp-Arg-Leu-Gly-… Answer/do the following (refer to the Codon Chart below): a. What was the most likely type of mutation (missense, nonsense, or frameshift) that occurred in the...
If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?
If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT