Question

In: Biology

Define 3 mutations and mention if a functional protein is made after translation or transcription of...

Define 3 mutations and mention if a functional protein is made after translation or transcription of each type.

Solutions

Expert Solution

Permanant change occurs in the nucleotide sequences of DNA during replication of recombination can be termed as "mutation".There are 3 types of DNA mutations.

■ Base Substitution mutation

Single base substitutions called point mutations.Most common type of mutations which are of two types mainly.

▪Transition: Occurs when a purine is substituted with another purine or when a pyrimidine is substituted with another pyrimidine.

▪Transversion: occurs when a purine is substituted with a pyrimidine or a pyrimidine replaces a purine.

At the level of translation, point mutations often manifest as functional changes in the final protein product. Thus, there exist functional groupings for point mutations.

Point mutations that occur in DNA sequences encoding proteins are either silent, mis-sense or non-sense.

•silent mutation:Silent mutations result in a new codon (a triplet nucleotide sequence in RNA) that codes for the same amino acid as the wild type codon in that position.
•Mis-sense mutations:Substitutions that result in functionally different amino acids.These can lead to alteration or loss of protein function.
•Non-sense mutations: Result in a stop codon in a position where there was not one before, which causes the premature termination of protein synthesis and a complete loss of function in the finished protein.


■.Deletion mutation

Resulting in a frameshift when one or more base pairs are lost from the DNA .

If one or two bases are deleted the translational frame is altered resulting in a garbled message and non functional product.

■ Insertion mutation

The insertion of additional base pairs may lead to frameshifts depending on whether or not multiples of three base pairs are inserted. A frameshift mutation shifts the grouping of these bases and changes the code for amino acids. The resulting protein protein is usually non functional.


Related Solutions

1. Explain the transcription and translation mechanism of protein and the role of GTP in translation...
1. Explain the transcription and translation mechanism of protein and the role of GTP in translation process I want to know the answer of this question less than one page
Explain the transcription and translation mechanism of protein and the role of GTP in translation process
Explain the transcription and translation mechanism of protein and the role of GTP in translation process
Question 3: Transcription and Translation Below is the beginning of the coding strand of the protein-coding...
Question 3: Transcription and Translation Below is the beginning of the coding strand of the protein-coding region of the Cdc7 gene in yeast. Note that only the coding strand of the DNA is shown. Please be sure to correctly label the ends of any DNA, RNA or protein sequence written below. 5’ATGACAAGCAAAACGAAGAATATCGATGATATACCTCCAGAAATCAAAGAAGAGATGA TACAGCTCTATCATGATCTACCGGGTATAGAAAATGAATATAAACTCATAGACAAGATC GGTGAGGGAACATTTTCGTCAGTGTATAAAGCCAAAGATATCACTGGGAAAATAATAG3’ A. What is the sequence of the first 10 nucleotides of the template strand? B. What is the sequence of the first 10 nucleotides of the...
Transcription is the process of RNA synthesis.  Translation is the cytoplasmic process of protein synthesis. Both processes...
Transcription is the process of RNA synthesis.  Translation is the cytoplasmic process of protein synthesis. Both processes can be divided into three stages, Initiation, Elongation, and Termination.  For each of the events listed below write which process it occurs in (either transcription or translation) and in which stage the event occurs (initiation, elongation, termination). Release factor binds to the stop codon in the amino acyl site and cuts away the protein from the transfer RNA. Transfer RNA anticodons bind to the messenger...
Transcription and Translation 1. Double strand of DNA: 5’-ATGTACCAGCATTCTCGATACCCT-3’ 3’-TACATGGTCGTAAGAGCTATGGGA-5’ mRNA strand made from the DNA:...
Transcription and Translation 1. Double strand of DNA: 5’-ATGTACCAGCATTCTCGATACCCT-3’ 3’-TACATGGTCGTAAGAGCTATGGGA-5’ mRNA strand made from the DNA: 5’-AUGUACCAGCAUUCUCGAUACCCU-3’ a) Which strand of the DNA is the template for mRNA synthesis? Select the correct answer: i. 5’ – 3’ ii. 3’ – 5’ (0.5 points) b) Draw an arrow on the DNA above, to show the direction of transcription i.e. in which order the nucleotides were added to create mRNA. (0.5 points) c) What is the peptide sequence of this piece of...
Transcription is the process of RNA synthesis.  Translation is the cytoplasmic process of protein synthesis.  Both processes can...
Transcription is the process of RNA synthesis.  Translation is the cytoplasmic process of protein synthesis.  Both processes can be divided into three stages, Initiation, Elongation, and Termination.  For each of the events listed below write which process it occurs in (either transcription or translation) and in which stage the event occurs (initiation, elongation, termination). a. Peptidyl transferase moves the peptide from the transfer RNA in the peptidyl site to the transfer RNA in the amino acyl site.             b. RNA polymerase binds to the...
Complete the following questions. Illustrates the process of DNA transcription, translation, and protein synthesis. 1.    The stages...
Complete the following questions. Illustrates the process of DNA transcription, translation, and protein synthesis. 1.    The stages of transcription are initiation, elongation, and termination. Draw a representation of each of these stages . Be sure to include the names of important enzymes and locations. 2.    Once mRNA is created through transcription, it is often processed. Explain how mRNA can be processed. Include the names of important enzymes or structures. 3.    Translation is how mRNA gets used to create the peptide sequence. Draw what...
Question 64 Mutations may be recessive because cells can increase the amount of functional protein produced...
Question 64 Mutations may be recessive because cells can increase the amount of functional protein produced from their remaining normal allele. True False Question 65 For genes which have multiple alleles, the relationships between those alleles can be a variety of types of dominant/recessive relationships. False True
During the process of    [1"replication", 2"translation", 3"transcription", "4RNA processing"] ______ , the anticodon on the   ["1amino...
During the process of    [1"replication", 2"translation", 3"transcription", "4RNA processing"] ______ , the anticodon on the   ["1amino acid",2 "ribosome", 3"tRNA", 4"mRNA"] _____ has to match the codon following base-pairing rules to ensure the proper amino acid is being added to the polypeptide sequence.
Combining Treatments. What is your thought? After reading the article, it made no mention of medication....
Combining Treatments. What is your thought? After reading the article, it made no mention of medication. http://www.nami.org/About-NAMI/NAMI-News/Can-Combining-Therapies-Have-a-Synergistic-Effect
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT