1. Explain the transcription and translation mechanism of protein and the role of GTP in translation...

1. Explain the transcription and translation mechanism of protein and the role of GTP in translation process

I want to know the answer of this question less than one page

Expert Solution

The central dogma of cell molecular biology is:

DNA to RNA to Proteins

DNA is formed by replication. DNA to RNA conversion is k/a transcription and finally RNA is translated to proteins.

Transcription: The three stages are Initiation, elongation and termination.

In this DNA is transcribed into pre-mRNA, which is then edited to prefer mRNA, which carries the information required for protein synthesis.

DNA is double stranded; out of which one strand (anti-sense) is transcribed to pre-mRNA, which is actually a copy of sense strand DNA. The direction of synthesis is 5’-3’. The transcription factors mediates the polymerase to initiate the transcription.

The pairing of NTPs is according to Watson and crick pairing with the help of enzyme RNA polymerase. The pairing continues until a triplet stop codon is formed. Then this pre-mRNA has some introns, which are spliced off k/a RNA splicing. Then a mature mRNA is ready to be translated into proteins. This mRNA is then transferred from nucleus to the ribosome, which is present on the mitochondria.

Translation: There are 4 phases of translation

1. Initiation: first t-RNA attaches to the mRNA

2. Elongation: The second t-RNA targets mRNA and then transfer of amino acid from first t-RNA to the second.

3. Translocation: the chain of amino acids is formed.

4. Termination: the stop codon releases the polypeptide from ribosomes.

m-RNA along with t-RNA forms a complex. M-RNA is codon while t-RNA is an anti-codon. The codon in mRNA interacts with the specific t-RNA to decode the mRNA codon. t-RNA at 3’ end has the corresponding amino acid attached.

The t-RNA picks the amino acid, which corresponds to the codon, and then delivers it to the ribosome.

Role of GTP: At the initiation step GTP is required. The GTP hydrolysis to GDP. GTP catalyzes the molecular motion.

Also, it is required in the elongation phase for the binding of new amino acid in t-RNA to A-site of ribosome. Also required for the translocation of ribosome towards the m-RNA 3’end.

gladiator answered 2 years ago

Explain the transcription and translation mechanism of protein and the role of GTP in translation process

Complete the following questions. Illustrates the process of DNA transcription, translation, and protein synthesis. 1. The stages...

Complete the following questions. Illustrates the process of DNA transcription, translation, and protein synthesis. 1. The stages of transcription are initiation, elongation, and termination. Draw a representation of each of these stages . Be sure to include the names of important enzymes and locations. 2. Once mRNA is created through transcription, it is often processed. Explain how mRNA can be processed. Include the names of important enzymes or structures. 3. Translation is how mRNA gets used to create the peptide sequence. Draw what...

Question 3: Transcription and Translation Below is the beginning of the coding strand of the protein-coding...

Question 3: Transcription and Translation Below is the beginning of the coding strand of the protein-coding region of the Cdc7 gene in yeast. Note that only the coding strand of the DNA is shown. Please be sure to correctly label the ends of any DNA, RNA or protein sequence written below. 5’ATGACAAGCAAAACGAAGAATATCGATGATATACCTCCAGAAATCAAAGAAGAGATGA TACAGCTCTATCATGATCTACCGGGTATAGAAAATGAATATAAACTCATAGACAAGATC GGTGAGGGAACATTTTCGTCAGTGTATAAAGCCAAAGATATCACTGGGAAAATAATAG3’ A. What is the sequence of the first 10 nucleotides of the template strand? B. What is the sequence of the first 10 nucleotides of the...

Define 3 mutations and mention if a functional protein is made after translation or transcription of...

Define 3 mutations and mention if a functional protein is made after translation or transcription of each type.

explain the process of Dna replication fork, transcription, translation

Transcription is the process of RNA synthesis. Translation is the cytoplasmic process of protein synthesis. Both processes...

Transcription is the process of RNA synthesis. Translation is the cytoplasmic process of protein synthesis. Both processes can be divided into three stages, Initiation, Elongation, and Termination. For each of the events listed below write which process it occurs in (either transcription or translation) and in which stage the event occurs (initiation, elongation, termination). Release factor binds to the stop codon in the amino acyl site and cuts away the protein from the transfer RNA. Transfer RNA anticodons bind to the messenger...

Define protein-primed DNA replication. Explain the general process of reverse transcription and integration. Explain the role...

Define protein-primed DNA replication. Explain the general process of reverse transcription and integration. Explain the role of tRNA in retrovirus genome replication, the enzymatic activities of the reverse transcriptase enzyme, and the function of the integrase enzyme.

Transcription is the process of RNA synthesis. Translation is the cytoplasmic process of protein synthesis. Both processes can...

Transcription is the process of RNA synthesis. Translation is the cytoplasmic process of protein synthesis. Both processes can be divided into three stages, Initiation, Elongation, and Termination. For each of the events listed below write which process it occurs in (either transcription or translation) and in which stage the event occurs (initiation, elongation, termination). a. Peptidyl transferase moves the peptide from the transfer RNA in the peptidyl site to the transfer RNA in the amino acyl site. b. RNA polymerase binds to the...

transcription and translation practice worksheet

Explain how the Rho protein terminates transcription.

Question