Question

In: Biology

Nucleotides of DNA are joined by a ____________ to form polynucleotides whereas amino acids are joined...

Nucleotides of DNA are joined by a ____________ to form polynucleotides whereas amino acids are joined by a ______________ to form polypeptides.

Group of answer choices

Phosphodiester linkage / hydrogen bond

Phosphodiester linkage / glycosidic bond

Peptide bond/ phosphodiester linkage

Hydrogen bond/ peptide bond

Phosphodiester linkage/ peptide bond


Solutions

Expert Solution

In the photos plz consider wherever I have written phosphodiester bond is actually phosphodiester linkage. Sorry for incovenience

ANSWERS - 4) Phosphodiester linkage. B) Peptide bond

nucleotides of DNA are joined by a Phosphodiester linkage.

s, Explanation Whereas Amino groups care joinod by a Peptide bond to form a polypeptides.


Related Solutions

Define polymer.  Nucleotides are polymerized to form _______ and ________ while amino acids are polymerized to form...
Define polymer.  Nucleotides are polymerized to form _______ and ________ while amino acids are polymerized to form ________. Metabolic energy is derived from the breakdown of _________ to form _______which can be used to build _______.  Define metabolism and compare and contrast (similarities and differences) catabolism with anabolism.  Lastly, why are viruses not considered to be alive? Draw a graph of a chemical reaction plotting Energy level on the Y axis and the reaction progress on the X access.  Show the energy level in...
If a polypeptide is composed of 319 amino acids, how many nucleotides were in the mRNA...
If a polypeptide is composed of 319 amino acids, how many nucleotides were in the mRNA transcript for the polypeptide? Show your work (math).
a)For mammals, some amino acids are essential in the diet, whereas others may be formed from...
a)For mammals, some amino acids are essential in the diet, whereas others may be formed from dietary components. Humans are capable of converting:aspartic acid into isoleucine. True/False? b)For mammals, some amino acids are essential in the diet, whereas others may be formed from dietary components. Humans are capable of converting:pyruvate to alanine. True/False? c)Nitrogen fixation (conversion of N2 to NH4+):requires the participation of CO2.True/False? d) Nitrogen fixation (conversion of N2 to NH4+):requires a powerful reductant. True/False? e)Nitrogen fixation (conversion of...
4. Amino acids are weak polyprotic acids. There they will readily form ________ systems which control...
4. Amino acids are weak polyprotic acids. There they will readily form ________ systems which control the pH of a system. a) Give an example of a biological system within the human body that is buffered. b) What is the pH of a glutamic acid solution if the alpha carboxyl group is 1⁄4 dissociated? c) Lysine is an amino acid with a basic side chain. Often, basic side chains accept protons and are thus positively charged. What could you do...
A gene is composed of DNA and a protein is composed amino acids. Describe the steps...
A gene is composed of DNA and a protein is composed amino acids. Describe the steps involved in converting the information contained in a gene into a protein. **Please include and define all of the following terms in your description:** Ribosome, template strand, non-template strand, reading frame, complementary, tRNA, mRNA, start codon, stop codon, transcription factors, 5’ to 3’, translation, transcription, gene promoter, RNA polymerase
For each of the following amino acids, draw the form that is expected to predominate at...
For each of the following amino acids, draw the form that is expected to predominate at physiological pH: (a) l-Isoleucine (b) l-Tryptophan (c) l-Glutamine (d) l-Glutamic acid
Below are the DNA sequences that encode the first eight amino acids for four alleles of...
Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC a. What are the first eight amino acids for each of these four DNA sequences? b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c. Synonymous polymorphisms tend to be more common...
Below are the DNA sequences that encode the first eight amino acids for four alleles of...
Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC a. What are the first eight amino acids for each of these four DNA sequences? b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c. Synonymous polymorphisms tend to be more common...
Below are the DNA sequences that encode the first eight amino acids for five alleles of...
Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh protein in Drosphila pseudoobscura. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC ATGTCTCTCACCAACAAGAACGTg a. What are the first eight amino acids for each of these five DNA sequences? b. For each of the five polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c. The fourth sequence shown above has...
Which statement does NOT describe DNA structure? The phosphates and sugars of the nucleotides form the...
Which statement does NOT describe DNA structure? The phosphates and sugars of the nucleotides form the “backbone” of the double helix. The two complementary strands are held together by hydrogen bonds. The nitrogen bases of the nucleotides project towards the center of the helix. The 5-carbon sugar in each nucleotide is ribose.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT