Question

C++ program, include comments stating what each part of code does please. I want to be able to understand it so I'll be more knowledgeable in the future. The program is multiple files(transcribe_dna_to_rna.h file, transcribe_dna_to_rna.cpp file, main.cpp file and loops_strings_test.cpp). After the directions I also included any starter code or comments left by my professor within the files to aide us.

Directions:

In folder 05_loops_strings write prototype and definition for string value - return function transcribe_dna_into_rna with a string parameter that returns the rna string. Write the required unit test(s) in folder 05_loops_strings_test. Main program flow: No loop. Use the given string as function argument call transcribe_dna_into_rna function and display the output.

transcribe_dna_to_rna.h

/*
	Create a function transcribe_dna_into_rna with a dna const reference string parameter that returns a string.
	*/

transcribe_dna_to_rna.cpp

//Write include statements
	/*
	An RNA string is a string formed from the alphabet containing 'A', 'C', 'G', and 'U'.
	Given a DNA string t corresponding to a coding strand, its transcribed RNA string u is formed by replacing
	all occurrences of 'T' in t with 'U' in u.
	Given: A DNA string
	Return: The transcribed RNA string of the DNA string
	Examle:
	dna_string: GATGGAACTTGACTACGTAAATT
	transcribe_dna_into_rna("GATGGAACTTGACTACGTAAATT");
	returns:
	GAUGGAACUUGACUACGUAAAUU
	*/

main.cpp

//Write include statements
	//Write using statements
	/*
	No loop.
	Use the string "GATGGAACTTGACTACGTAAATT" call the transcribe_dna_into_rna function and display the result
	*/
	int main()
	{
	return 0;
	}

loops_strings_test.cpp

#define CATCH_CONFIG_MAIN // This tells Catch to provide a main() - only do this in one cpp file
	#include "catch.hpp"
	//Write include statements
	/*
	Write test case for transcribe dna to rna with string:
	"GATGGAACTTGACTACGTAAATT" returns GAUGGAACUUGACUACGUAAAUU
	*/

Answer 1

// transcribe_dna_to_rna.h

//function for converting DNA to RNA

string transcribe_dna_into_rna(string t){

string u = "";

//iterating over whole DNA string t to construct RNA string u

for(int i=0;i<t.length();i++){

//checking if character at position i is T which needs to be converted to U

if(t[i]=='T'){

//if T exists at position i then we add U in place of T

u += 'U';

}else{

//if any other character appears in other than T then we add the correcponding character to RNA string

u += t[i];

}

}

return u;

}

// main.cpp

#include<iostream>

#include "transcribe_dna_to_rna.h"

using namespace std;

int main(){

//calling function transcribe_dna_into_rna to convert DNA to RNA;

string rna = transcribe_dna_into_rna("GATGGAACTTGACTACGTAAATT");

cout<<rna<<endl;

return 0;

}

// loops_strings_test.cpp

#define CATCH_CONFIG_MAIN // This tells Catch to provide a main() - only do this in one cpp file

#include "catch.hpp"

#include "transcribe_dna_to_rna.h" //including our header file

//writing test case for the function RNA to DNA

TEST_CASE("Testing DNA to RNA function") {

//calling the function and then comparing with the correct data, REQUIRE ensures that the condition is matched else the test case will fail

REQUIRE(transcribe_dna_into_rna("GATGGAACTTGACTACGTAAATT").compare("GAUGGAACUUGACUACGUAAAUU")==0)

}

Hope this helps. Please upvote. thanks.