Question

In: Biology

One of the first steps in comparing the DNA is obtaining DNA from all of the...

One of the first steps in comparing the DNA is obtaining DNA from all of the sources and using a specific enzyme to clip the DNA at different sites. What is this class of enzymes that would complete this to compare DNA from different organisms

Solutions

Expert Solution

Restriction enzymes are the class of enzymes which can cut DNA at different sites to compare the DNA from different organisms.

A restriction enzyme (restriction endonuclease) is a protein that recognizes a specific, short nucleotide sequence and cuts the DNA only at that specific site, which is known as restriction site or target sequence. When a restriction endonuclease recognizes a sequence, it snips through the DNA molecule by catalyzing the hydrolysis (splitting of a chemical bond by addition of a water molecule) of the bond between adjacent nucleotides.

The DNA of different organisms can be subjected to restriction endonuclease treatment, it will be cleaved into fragments. These fragments can be visualized and thus the DNA of different organisms can be compared.

This can be done by seperating the DNA fragments by size, by performing electrophoresis in agarose or acrylamide gel. Thus the DNA fragments can be visualised, and compared.


Related Solutions

write the steps on obtaining a midstream urine sample from a pregnant woman
write the steps on obtaining a midstream urine sample from a pregnant woman
Summarize the methods of performing a phylogenetic analysis--- from obtaining the DNA sequence data to making...
Summarize the methods of performing a phylogenetic analysis--- from obtaining the DNA sequence data to making and editing a phylogenetic tree. How would you calculate intraspecific and interspecific divergences?
QUESTION 1 During DNA replication, which of the following steps occurs first? a. sealing of the...
QUESTION 1 During DNA replication, which of the following steps occurs first? a. sealing of the nicks between short DNA b. synthesis of the leading strand c. unwinding of the parental DNA duplex d. synthesis of the lagging strand e. synthesis of primers QUESTION 2 A gene can be defined as "a segment of DNA that encodes for __________ "? a. all types of RNA b. a functional product c. ribosomal RNA d. protein e. messenger RNA QUESTION 3 Which...
Then provide one full page of text comparing all 6 results from the table above and...
Then provide one full page of text comparing all 6 results from the table above and explaining which company would you invest in and why? Company Stock Price Shares Outstanding Dividend Annual Dividend Market Cap Dividend Yield Walmart Inc (WMT) 119.21 2,830,000,000 $0.54 $2.16 $337,360,000,000 1.81% Target Corp (TGT) 119.12 500, 020, 000 $0.68 $2.72 59,560, 000,000 2.28% COSTCO (COST) 305.74 441,520, 000 $0.70 $2.80 134,990,000,000 0.92%
1) Describe the process and steps involved in the production of a protein from a DNA...
1) Describe the process and steps involved in the production of a protein from a DNA blueprint.
One of the prerequisites for obtaining a collection alternative from the IRS is: Filing compliance. Payment...
One of the prerequisites for obtaining a collection alternative from the IRS is: Filing compliance. Payment compliance. An unpaid balance for no more than three years. Both 1 and 2.
Using your knowledge of DNA replication, copy the following. Write down all the important steps and...
Using your knowledge of DNA replication, copy the following. Write down all the important steps and players of the reaction. Show the primer location and derive the complimentary strand sequence. 5` - AGATTCTGAGTCGTGACTCGTACGTCATAACTT -3`
Review the necessary steps to obtaining an accurate and proper record of vital signs. Discuss the...
Review the necessary steps to obtaining an accurate and proper record of vital signs. Discuss the impact of patient comfort and equipment on getting the vital signs effectively.
Arrange the steps of transcription of DNA to synthesize mRNA.
Arrange the steps of transcription of DNA to synthesize mRNA. Rank the steps of transcription of DNA to synthesize mRNA. To rank items as equivalent, overlap them.
describe the steps involved in PCR DNA amplification?
describe the steps involved in PCR DNA amplification?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT