Question

In: Biology

Summarize the methods of performing a phylogenetic analysis--- from obtaining the DNA sequence data to making...

Summarize the methods of performing a phylogenetic analysis--- from obtaining the DNA sequence data to making and editing a phylogenetic tree. How would you calculate intraspecific and interspecific divergences?

Solutions

Expert Solution

The methods of performing a phylogenetic analysis - from obtaining the DNA sequence data to making and editing a phylogenetic tree are-

There are four major steps that are involved-

• The homologous DNA sequence between different species are identified and acquired or any protein sequences which is similar

• These sequences are then aligned.

• A rough tree is predicted on the basis of these sequences

• Then the tree is clearly modified , analysed and then final is made for clear interpretation.

The way by which we can calculate interspecific and intraspecific divergences are-

• We can calculate nucleotide frequency difference to identify sequence homogenization at the monomeric level to exploit the differences in between species.

• The protein sequences can also be studied to calculate the specific divergences so that the individuals can not only separated on the basis of differentiable characters but also at genetic level as well .

If you like my answer please upvote


Related Solutions

Obtaining Data. Discuss the methods for obtaining data. Describe each method.
Obtaining Data. Discuss the methods for obtaining data. Describe each method.
Discuss the methods for obtaining data. Describe each method.
Discuss the methods for obtaining data. Describe each method.
Java: create a program that reads in a piece of DNA sequence from a sequence file...
Java: create a program that reads in a piece of DNA sequence from a sequence file (dna.seq) (alternatively you can use the getRandomSeq(long) method of the RandomSeq class to generate a piece of DNA sequence), and then print out all the codons in three forward reading frames. Design a method called codon() that can be used to find all the codons from three reading frames. The method will take in an argument, the reading frame (1, 2, or 3), and...
. Summarize the process of performing a cost-benefit analysis to determine the efficient level of pollution...
. Summarize the process of performing a cost-benefit analysis to determine the efficient level of pollution abatement. Identify common difficulties as well as shortcomings and positive aspects of such an analysis.
In the following partial sequence of prokaryotic DNA, circle the consensus sequence upstream from the initiation...
In the following partial sequence of prokaryotic DNA, circle the consensus sequence upstream from the initiation site that facilitates the local unwinding indicate the initiation start site with an (*) Indicate the RNA that would be transcribed by RNA pol II (indicate 5’ and 3’ ends) Underline the TEMPLATE strand. 3’   A G C G T T A T A C T T A T G C T C G T A A T A T C T G A...
The following is based on the DNA sequence and one of the oligos from the previous...
The following is based on the DNA sequence and one of the oligos from the previous problem set, which are reproduced below: 5'...GGAGCTTCATGCTAGTTGCAATAGC..[1,150 bp]..CGTGGCACGTATAGCGCTATCATTA...3'       oligo-B: CATGCTAGTTGC      a) If oligo-B is used as a primer for (Sanger) DNA sequencing, which type of dideoxynucleotide would be found on the “first” (shortest) chain to terminate synthesis? b) If oligo-B is used a sequencing primer, what the total length (number of nucleotides) of the SHORTEST DNA chain that would have a dideoxy-G (ddG, 2',3'-dideoxyguanosine)...
1) What are commons errors derived from the phylogenetic analysis? What are the implications of these...
1) What are commons errors derived from the phylogenetic analysis? What are the implications of these errors? 5) List two methods to assess the validity of pylogenetic trees.
You will be performing an analysis on a dataset that contains data on fertility and life...
You will be performing an analysis on a dataset that contains data on fertility and life expectancy for 198 different countries. All data is from the year 2013. The fertility numbers are the average number of children per woman in each of the countries. The life expectancy numbers are the average life expectancy in each of the countries. You will be turning in a paper that should include section headings, graphics and tables when appropriate and complete sentences which explain...
The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The...
The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The strand is transcribed from left to right and codes for a small peptide. a) Is this the mRNA-like coding strand or template strand? b) Which end is the 3' end and which is the 5' end? c) What is the DNA coding strand sequence of the ORF ? d) What is the sequence of the entire transcript (assume the +1 of transcription begins at...
From phylogenetic analysis of present day bacteria why do we believe that the bacteria have a...
From phylogenetic analysis of present day bacteria why do we believe that the bacteria have a thermophilic ancestry?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT