describe the steps involved in PCR DNA amplification?

Expert Solution

Answer-

1. Polymerase chain reaction (PCR) is technique in which DNA is synthesized in thermocycler. PCR is use to amplify template DNA in controlled temperature inside the thermocycler. In the reaction mixture of PCR target DNA to be amplified, dNTPs, Taq DNA polymerase, forward and reverse primers, buffer and Mg2+ ions are added in proper concentration. Then polymerization is done in a machine known as thermocycler and the Steps of PCR are-

1. DENATURATION- This is the first step of PCR in which PCR reaction mixture is heated between temperature 90-98°C for 2min to denature DNA so that this step is known as denaturation. At the end of this step two strands of dsDNA gets separated and then in next step primer can anneal with both separated DNA strands.

2. ANNEALING- in this second step of PCR, temperature of reaction mixture is cooled to 40-60°C for 1min. This allows annealing of primer to the complementary sequence of target DNA which is present at 3' end of both DNA strands. In this step primer anneals with DNA so that this step is known as annealing.

3. PRIMER EXTENSION- this is third and last step of PCR in which DNA polymerase synthesizes new DNA strand complementary to template DNA using 3'-OH of primer and DNA is synthesized in 5' to 3' direction by adding new nucleotides at 3' end of primer. Extension occurs at 72°C for 2min . In this step primer is extended by DNA polymerase so that this step is known as primer extension.

After certain number of cycles, DNA is amplified and multiple copies of DNA are synthesized in reaction.

gladiator answered 2 years ago

Explain in detail each of the steps of PCR involved in the amplification of a specific...

Explain in detail each of the steps of PCR involved in the amplification of a specific region of DNA

PCR takes advantage of the steps of DNA replication. Match each step of PCR with the...

PCR takes advantage of the steps of DNA replication. Match each step of PCR with the protein that the PCR step has replaced.

Describe the steps involved in DNA replication including the function of a replication fork and the...

Describe the steps involved in DNA replication including the function of a replication fork and the enzyme and enzyme function.

1) Describe the process and steps involved in the production of a protein from a DNA...

1) Describe the process and steps involved in the production of a protein from a DNA blueprint.

Explain the principles of PCR using the following headings (20 marks). DNA isolation Amplification Gel electrophoresis...

Explain the principles of PCR using the following headings . DNA isolation Amplification Gel electrophoresis of PCR products

Briefly explain the steps that are involved in DNA replication. And Briefly describe how errors in...

Briefly explain the steps that are involved in DNA replication. And Briefly describe how errors in DNA replication are corrected.

Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA...

Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication: ATCGGCTAGCTACGGCTATTTACGGCATAT TAGCCGATCGATGCCGATAAATGCCGTATA

As a reminder, PCR is the technique used to replicate DNA in the lab. PCR is...

As a reminder, PCR is the technique used to replicate DNA in the lab. PCR is based on the way DNA is replicated in cells. During PCR template DNA plus other ingredients are placed in a test tube and the solution goes through repeated cycles of heating and cooling. The 'ingredients' of a basic PCR reaction are: DNA template, primer, nucleotides, DNA polymerase, and any salts required for polymerase function (buffer). No ligase is required in PCR but it is...

Describe the steps in the process of transcription of DNA to RNA.

in pcr practical, Briefly describe the reaction mechanism leading to the synthesis of a new DNA...

in pcr practical, Briefly describe the reaction mechanism leading to the synthesis of a new DNA strand by Taq DNA polymerase. In your answer include: i. The mechanism of the synthesis reaction, ii. The direction of the synthesis reaction iii. The direction in which sequence information is read from the template strand.

Question