Nuclear receptors carry a binding site for a signal molecule and for a DNA sequence. How...

Nuclear receptors carry a binding site for a signal molecule and for a DNA sequence. How is it that identical nuclear receptors in different cells can activate different genes when they bind to the same signal molecule?

Solutions

Expert Solution

Nuclear receptors (NR)are present in the cytoplasm and bind to steroid hormones. Upon dimerization (joining of two NR), the receptor gets activated and lead to cellular response by:

Binding to certain other transcription factors present in the cytoplasm, or
Directly cross the nuclear pore and bind to response element (RE) in the DNA.

This means that the nuclear receptors are subject to different internal processing upon binding of the same ligand in different cells.

Hence, in essence, the nuclear receptors act as transcription factors that may interact with other transcription factors or bind directly to DNA response element.

Due to this difference in internal machinery of different cells to process nuclear receptors upon activation, the identical nuclear receptors in different cells can activate different genes when they bind to the same signal molecule.

gladiator answered 1 year ago

Next > < Previous

Related Solutions

A. Discuss how nuclear import receptors such as importin function to carry proteins into the nucleus....

A. Discuss how nuclear import receptors such as importin function to carry proteins into the nucleus. Discuss: 1) how nuclear import receptors choose proteins for import: 2) the mechanism by which they get into the nucleus, including any other structures, molecules or molecular interactions involved; and 3) the mechanism by which nuclear proteins are released into the nucleus, as well as any important molecular interactions that are necessary for this process

Draw an IgG molecule and identify the following parts: Antigen-binding site Complement-binding region Macrophage-binding site Variable...

Draw an IgG molecule and identify the following parts: Antigen-binding site Complement-binding region Macrophage-binding site Variable region Hinge region

Discuss how nuclear hormone receptors work, and the diversity of their DNA targets, or response elements,...

Discuss how nuclear hormone receptors work, and the diversity of their DNA targets, or response elements, and physiological effects. Be specific.

What do both G protein-coupled receptors and tyrosine kinase receptors have in common? The binding site...

What do both G protein-coupled receptors and tyrosine kinase receptors have in common? The binding site for the signaling molecule is located on the outside of the cell. They both interact with G proteins. Binding of the signaling molecule forms a dimer. They both result in a phosphorylation cascade.

A. The vast majority of the DNA sequence of a plant nuclear genome is composed of...

A. The vast majority of the DNA sequence of a plant nuclear genome is composed of repetitive DNA with only a small fraction of the genome space representing protein coding gene sequences. Discuss the structure of chromatin in repeat-rich and gene-rich regions of the plant nuclear genome, including the methylation status of the DNA in these two distinct genome regions. Also, describe the conformational change in chromatin structure required to promote gene expression and explain why this conformational change is...

Given a DNA molecule with 10,000bp, in theory how many times the “GTCCGGAC” sequence is expected?...

Given a DNA molecule with 10,000bp, in theory how many times the “GTCCGGAC” sequence is expected? And how about “ATWAT” sequence? (Where W= A or T)

13. A) A change to a single base pair in the sequence of a DNA molecule...

13. A) A change to a single base pair in the sequence of a DNA molecule is called a ______ mutation. B) If that single nucleotide change results in a protein with the exact same amino acid sequence it is called a _________ mutation. C) If the base pair change results in an alteration of the amino acid sequence of the protein it is called a ___________ mutation. D) If the base pair changes results in a codon for an...

The sequence below represents the DNA sequence of the polylinker (also called the multiple cloning site)...

The sequence below represents the DNA sequence of the polylinker (also called the multiple cloning site) on a plasmid, with the dots (...) on either side representing the continuing DNA on either side of the polylinker .............5' CACTTAAGCCTGCAGCGTTAGCGT 3'......... ..............3' GTGAATTCGGACGTCGCAATCGCA 5'.......... The plasmid is cut with the restriction endonuclease Pst1, which recognizes the following sequence: -------- -- -5' CTGCAG 3' and which cuts between the A and the G nucleotides. A. After cutting the plasmid with Pst1, how many...

A promoter is ______. a. a sequence in DNA that brings RNA polymerase near the site...

A promoter is ______. a. a sequence in DNA that brings RNA polymerase near the site for transcription b. one or more eukaryotic proteins that bind to DNA near the start of a gene c. a protein that associates with bacterial RNA polymerase to help it bind to DNA d. a sequence in RNA that promotes the release of RNA polymerase from DNA Which of the following statements best describes the promoter of a protein-coding gene? a. A site where...

. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that...

. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TAC ATG ATC ATT TCA CGG AAT TTC TAG CAT GTA ATG TAC TAG TAA AGT GCC TTA AAG ATC GTA CAT a. Which strand of DNA is transcribed and in which direction? Support your response by indicating the 5 amino acid sequence that results when this transcript is translated. (2 pts) b. Label the 5’ and the 3’...

Subjects