Question

In: Biology

Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’...

Part A:

The following sequence encodes a protein in the virus genome:

5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’

3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’

How many amino acids long is the protein?

Part B:

A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Part A.

True/False

Solutions

Expert Solution

Part A

In the given DNA, the lower strand acting as the template strand for transcription. Hence the sequence of the mRNA produced by transcription is

5'- UCU AAA AUG UCA GAU GUA UUG UGC ACA UCA GUA GUC UUA CUC UCA GUU UUG UAA CAA CUC- 3'

In the given sequence, the third codon AUG is the start codon and 18th is the stop codon. Hence the protein has 15 amino acids. The amino acid sequence of the protein is

Met - Ser- Asp- Val- Leu- Cys- Thr- Ser- Val- Asp- Leu- Leu- Ser- Val- Leu- Stop.

Part B

Point mutation is the mutation happening in a single base and the base substitution, the replacement of an existing base with another base during DNA replication can lead to this. In nonsense mutation, the stop codon will insert into the coding region of a gene due to base substitution. there are three stop codons which are UAA, UAG, and UGA. In the given sequence, a base substitution in the twentieth base, substitution from A to T can cause nonsense mutation

Then the answer is TRUE


Related Solutions

You are studying a gene that encodes a particular protein; part of the amino acid sequence...
You are studying a gene that encodes a particular protein; part of the amino acid sequence of that protein is shown below: …-His-Val-Pro-Thr-Asp-Leu-Glu-… You isolate a mutant version of this protein; the mutation abolishes the function of the protein. When you sequence the mutant protein, you see the following amino acid sequence:    …-His-Val-Leu-Asp-Arg-Leu-Gly-… Answer/do the following (refer to the Codon Chart below): a. What was the most likely type of mutation (missense, nonsense, or frameshift) that occurred in the...
Below is the sequence for the SARS-CoV-2 spike protein that encodes a 1757 amino acid protein...
Below is the sequence for the SARS-CoV-2 spike protein that encodes a 1757 amino acid protein capable of binding surface receptors on some cell types. The nucleotide sequence is from base pair 21,563 to 25,384 in the viral genome (numbers in left-most column). Upon binding, the virus is uptaken into the cell, the coat is shed, and viral RNA released into the cytoplasm. When this occurs, host cell ribosomes begin transcription and translation of the RNA, including this protein. In...
how can a virus encode a protein larger than the size of its genome?
how can a virus encode a protein larger than the size of its genome?
A 3000 bp region of the human genome encodes two genes. One of the genes encodes...
A 3000 bp region of the human genome encodes two genes. One of the genes encodes a protein of 700 amino acids and the other gene encodes a protein of 310 amino acids. The mRNA sequences of the two genes do not contain any of the same nucleotide sequences. How is this possible? Fully explain your answer.
A 3000 bp region of the human genome encodes two genes. One of the genes encodes...
A 3000 bp region of the human genome encodes two genes. One of the genes encodes a protein of 700 amino acids and the other gene encodes a protein of 310 amino acids. The mRNA sequences of the two genes do not contain any of the same nucleotide sequences. How is this possible? That's all the information given. I think I'm supposed to mention terms like "reading frame" but this question doesn't make any sense
1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’...
1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ 2) Design a set of 6 base pair long primers that scientists could use to amplify the entire sequence of the gene in Q1 3) T/F. A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Q1.
What phenomenon explains the following data? Virus 1 - 100 Kb genome, 99 Kb protein coding...
What phenomenon explains the following data? Virus 1 - 100 Kb genome, 99 Kb protein coding Virus 2 - 1 Mb genome, 998 Kb protein coding Bacterium 1 - 5 Mb genome, 4.9 Mb protein coding Bacterium 2 - 11 Mb genome, 10.8 Mb protein coding Plant - 5000 Mb genome, 15 Mb protein coding Fungus - 50 Mb genome, 11 Mb protein coding Grasshopper - 500 Mb genome, 18 Mb protein coding Snake - 1200 Mb genome, 19 Mb...
what are the consequences for the protein that the gene encodes?
what are the consequences for the protein that the gene encodes?
Describe the effect of a mutation in the gene that encodes for the C3 protein of...
Describe the effect of a mutation in the gene that encodes for the C3 protein of the complement pathway.
5. In the story so far: a.In what order in the Ebola virus genome did you...
5. In the story so far: a.In what order in the Ebola virus genome did you place the genes? b.How did each of the Ebola virus weapons VP35, VP24, and GP/sGP play a role in the game? c.What weapons did the host use to fight back? Which host response overcame the Ebola virus infection, if any?d.What was your score? 6. Propose what is likely happening clinically to an individual infected with Ebola virus during this time point. Note that the...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT