5. In the story so far: a.In what order in the Ebola virus genome did you...

5. In the story so far:

a.In what order in the Ebola virus genome did you place the genes?

b.How did each of the Ebola virus weapons VP35, VP24, and GP/sGP play a role in the game?

c.What weapons did the host use to fight back? Which host response overcame the Ebola virus infection, if any?d.What was your score?

6. Propose what is likely happening clinically to an individual infected with Ebola virus during this time point. Note that the virus has already entered the host and is starting to deploy its arsenal of weapons.

Expert Solution

equence analysis of the second through the sixth genes of the Ebola virus (EBO) genome indicates that it is organized similarly to rhabdoviruses and paramyxoviruses and is virtually the same as Marburg virus (MBG). In vitro translation experiments and predicted amino acid sequence comparisons showed that the order of the EBO genes is: 3'-NP-VP35-VP40-GP-VP30-VP24-L. The transcriptional start and stop (polyadenylation) signals are conserved and all contain the sequence 3'-UAAUU. Three base intergenic sequences are present between the NP and VP35 genes (3'-GAU) and VP40 and GP genes (3'-AGC), and a large intergenic sequence of 142 bases separates the VP30 and VP24 genes. Novel gene overlaps were found between the VP35 and VP40, the GP and VP30, and the VP24 and L genes. Overlaps are 20 or 18 bases in length and are limited to the conserved sequences determined for the transcriptional signals. Stem-and-loop structures were identified in the putative (+) leader RNA and at the 5' end of each mRNA. Hybridization studies showed that a small second mRNA is transcribed from the glycoprotein gene, and is produced by termination of transcription at an atypical polyadenylation signal located in the middle of the coding region. The predicted amino acid sequence of the glycoprotein contains an N-terminal signal peptide sequence, a hydrophobic anchor sequence, and 17 potential N-linked glycosylation sites. Alignment of predicted amino acid sequences showed that the structural proteins of EBO and MBG contain large regions of homology despite the absence of serologic cross-reactivity.

gladiator answered 2 years ago

what is ebola virus? what causes ebola virus? what are syptoms of ebola virus?

what is ebola virus? what causes ebola virus? what are syptoms of ebola virus? what is the nucleic acid and capsid of ebola virus?

1) what genome does the Ebola virus have? How does this genome prevent vaccination? 2) what...

1) what genome does the Ebola virus have? How does this genome prevent vaccination? 2) what is the natural reservoir for the Ebola virus? How does the Ebola virus move from the reservoir to humans? 3) How is the Ebola virus transmitted from person to person? Does wearing a surgical mask help prevent the spread of the Ebola virus? 4) what would suggest to help prevent the spread of the virus in West Africa? 5) Is a large scale Ebola...

Which, if any, of the immunoassays we have discussed so far, have you used? What did...

Which, if any, of the immunoassays we have discussed so far, have you used? What did you like about them, or dislike? If you haven’t used any so far, can you describe the methodology of some over the counter tests such as a home pregnancy test?

What type of threat posed to the United States by ebola virus outbreak

UAUAGC is the genome of a virus. What is the resulting mRNA and what intermediates nucleotide...

UAUAGC is the genome of a virus. What is the resulting mRNA and what intermediates nucleotide sequences are needed (if any) to produce the mRNA if the above virus is a: a. influenza virus? b. coronavirus? c. T4 phage?

Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’...

Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ How many amino acids long is the protein? Part B: A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Part A. True/False

What type of threat posed to the United States by Ebola virus outbreak? Provide references in...

What type of threat posed to the United States by Ebola virus outbreak? Provide references in APA format

What have you learned so far about what determines prices such as the rent for an...

What have you learned so far about what determines prices such as the rent for an apartment? If people cannot afford rent, what are they to do? What are the consequences of controlling rent and for not controlling it? Is the current system fair?

What did you get out of the book,The Airbnb Story by Leigh Gallagher.

Reflect on and relate to what you have learned so far in the course with respect...

Reflect on and relate to what you have learned so far in the course with respect to your ability to calculate gross domestic product and its impact on the economy’s business cycle, unemployment, and inflation; using gross domestic product formulate recommendations for a government’s role in achieving full employment in an economy.

Question