Question

In: Biology

A 3000 bp region of the human genome encodes two genes. One of the genes encodes...

A 3000 bp region of the human genome encodes two genes. One of the genes encodes a protein of 700 amino acids and the other gene encodes a protein of 310 amino acids. The mRNA sequences of the two genes do not contain any of the same nucleotide sequences. How is this possible? Fully explain your answer.

Solutions

Expert Solution

mRNA sequences are transcribed from the DNA and synthesise protein . Nucleotide sequences on mRNA are arranged as codon. Codons are the group of three nucleotide sequences on mRNA. These codons specifies particular amino acids. The mRNA sequences of the two genes do not contain any of the same nucleotide sequences. This can be possible as DNA nucleotide sequences are varried in human genome. Two genes may undergo mutation which is a random chanegs in the nucleotide sequences or it may undergo genetic recombination in which genetic material is rearranged. Insertion or deletion of one or many nucleotides during the DNA replication process can lead to frameshift mutation. This insertion or deletion of any base can alter the complete sequence and thus the reading frame of mRNA will be completely changed. suppose the RNA seqence that codes foraminoacids are as follows:

AAA AUG UUC CGA CGC AGG GUG

now if mutation occur and if deletion occurs at fifth nucleotide in the sequence the complete set is changed and read as:

AAA AGU UCC GAC GCA AAA UG

Like that any addition of base in the sequence also results in sequence alteration.

Rate of recombination determines the base composition.

Besides mutation and recombination GC content also show high heterogenity in human genome. GC rich regions have less number of introns and shows compact genes but GC poor regions have large number of introns.

RNA editing at the time of post transcriptional modification may also causes change in nucleotide sequence. In RNA editing mRNA is modifiedas cytosine undergoes deamination and converted into uracil. Or adenine converted into inosine which behaves like guanosine. This process is site specific base mutation.


Related Solutions

A 3000 bp region of the human genome encodes two genes. One of the genes encodes...
A 3000 bp region of the human genome encodes two genes. One of the genes encodes a protein of 700 amino acids and the other gene encodes a protein of 310 amino acids. The mRNA sequences of the two genes do not contain any of the same nucleotide sequences. How is this possible? That's all the information given. I think I'm supposed to mention terms like "reading frame" but this question doesn't make any sense
9. Most of the genes in the human genome code for enzymes. Why? What are the...
9. Most of the genes in the human genome code for enzymes. Why? What are the functions of enzymes?
Human FAV gene's coding region is 7440 bp long however the produced protein is 680 amino...
Human FAV gene's coding region is 7440 bp long however the produced protein is 680 amino acid long. What is the reason? Explain scientifically using NUMBERS.
What is the primary function of rRNA? : * (A) rRNA encodes the messages for genes...
What is the primary function of rRNA? : * (A) rRNA encodes the messages for genes which are then translated by ribosomes in the cytoplasm. (B) rRNA anticodons are paired with codons by ribosomes to assemble nascent peptides during translation. (C) rRNA is the nucleic acid component of ribosomes and binds RNA messages during translation. (D) rRNA encodes a gene in the nucleus of a cell prior to transcription by host polymerases.
1) Give two mechanisms by which new genes are introduced into a genome 2) in 20...
1) Give two mechanisms by which new genes are introduced into a genome 2) in 20 words or less describe a "dominant-negative" mutation 3) explain the differences between an activator and inducer
Describe what is meant by the terms ‘pan genome’ and ‘core genome.’ What sorts of genes...
Describe what is meant by the terms ‘pan genome’ and ‘core genome.’ What sorts of genes do you expect to be present in the core genome? What sorts of genes are found in the pan genome but outside the core genome? What processes of genetic exchange give rise to the great diversity of genome sequences in the various strains of a given species?
Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’...
Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ How many amino acids long is the protein? Part B: A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Part A. True/False
A generous estimate of how much of our genome encodes an RNA accounts for only about...
A generous estimate of how much of our genome encodes an RNA accounts for only about 1/14th of its length; what else is in our genome? At the end of class I made the calculation that showed only 250,000,000 base pairs of our genomes 3,400,000,000 bp. And I briefly introduced a few things we have discovered in what used to be considered 'junk' DNA. Before class on Tuesday, I'd like you to discover more about what research is discovering in...
what best describes the human genome?
what best describes the human genome?
Most mitochondrial genes are encoded by the nuclear genome True False
Most mitochondrial genes are encoded by the nuclear genome True False
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT