how can a virus encode a protein larger than the size of its genome?

Expert Solution

gladiator answered 5 months ago

Please solve the riddle, how can a virus encode a protein larger than the size of...

Please solve the riddle, how can a virus encode a protein larger than the size of its genome?

For a ssRNA- virus, explain how it Replicates its genome, and expresses its own genes.

Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’...

Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ How many amino acids long is the protein? Part B: A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Part A. True/False

VIRUS SIZE GENOME REPLICATION HOSTS DISEASES MISCELLANEOUS herpesvirus parvovirus rotavirus poliovirus influenza HIV

What phenomenon explains the following data? Virus 1 - 100 Kb genome, 99 Kb protein coding...

What phenomenon explains the following data? Virus 1 - 100 Kb genome, 99 Kb protein coding Virus 2 - 1 Mb genome, 998 Kb protein coding Bacterium 1 - 5 Mb genome, 4.9 Mb protein coding Bacterium 2 - 11 Mb genome, 10.8 Mb protein coding Plant - 5000 Mb genome, 15 Mb protein coding Fungus - 50 Mb genome, 11 Mb protein coding Grasshopper - 500 Mb genome, 18 Mb protein coding Snake - 1200 Mb genome, 19 Mb...

1) what genome does the Ebola virus have? How does this genome prevent vaccination? 2) what...

1) what genome does the Ebola virus have? How does this genome prevent vaccination? 2) what is the natural reservoir for the Ebola virus? How does the Ebola virus move from the reservoir to humans? 3) How is the Ebola virus transmitted from person to person? Does wearing a surgical mask help prevent the spread of the Ebola virus? 4) what would suggest to help prevent the spread of the virus in West Africa? 5) Is a large scale Ebola...

1. Once a + strand RNA virus has released its genome into a cell, describe the...

1. Once a + strand RNA virus has released its genome into a cell, describe the synthesis stage (ONLY) of the virus replicative cycle. 2. Describe the absorption phase of an enveloped RNA virus. 3. How does Acyclovir and its various forms relieve the symptoms of herpes? 4. Contrast mumps infection in children versus an adult male. 5. How do AZT and other nucleotide analogs control the AIDS virus? How do protease inhibitors work? 6. Describe the structure and functions...

Explain how column chromatography can be used to separate a mixture on a larger scale than...

Explain how column chromatography can be used to separate a mixture on a larger scale than TLC?

Life insurance companies tend to be larger in asset size than casualty insurance companies because of...

Life insurance companies tend to be larger in asset size than casualty insurance companies because of _____ Their special income tax exclusions The selective underwriting processes for policy issuances The long-term, accumulative nature of whole life policies The characteristics of their term policies

How many integers larger than 3, 000, 000 can be formed by arranging the digits 1,...

How many integers larger than 3, 000, 000 can be formed by arranging the digits 1, 1, 2, 5, 5, 6, 9? How many can we form so that the digit is immediately followed by a larger digit?

Question