A 3000 bp region of the human genome encodes two genes. One of the genes encodes...

A 3000 bp region of the human genome encodes two genes. One of the genes encodes a protein of 700 amino acids and the other gene encodes a protein of 310 amino acids. The mRNA sequences of the two genes do not contain any of the same nucleotide sequences. How is this possible?

That's all the information given. I think I'm supposed to mention terms like "reading frame" but this question doesn't make any sense

Solutions

Expert Solution

Yes mate, it is completely possible. A single genomic region can code for multiple mRNA sequences. It can happen due to variable mRNA editing, and reading frame is not entirely concerned with this question.

Due to a phenomena called alternate splicing/differential splicing , this situation is possible. Once mRNA is transcribed from DNA, then its editing takes place. Few useless or non-functional regions of mRNA are removed out, and the remaining segment is translated into Protein. By doing variations in coding region, we can obtain multiple proteins from a single nucleotide sequence. The same nucleotide sequence might contain exons of Protein 1 as well as Protein 2. When mRNA of Gene 1 is expressed, then the portion of nucleotides in Gene 2 are spliced/removed from the sequence. So only exons of Gene 1 will remain in mRNA and it'll be transcribed into Protein 1, due to change in reading frame of codons.

700 amino acids means 700 x 3 = 2100 nucleotides.

So 900 nucleotides will be spliced out from the mRNA sequence to get Protein 1

Similarly when Gene 2 is translated, the exons of Gene 1 will be removed. So due to change in reading frame of the codons, the mRNA sequence coding for Protein 2 will be translated.

310 amino acid means 310 x 3 = 930 nucleotides.

So 2070 different nucleotides will be spliced out from the mRNA sequence to get Protein 2.

You may go through Alternate Splicing in detail, if you want further clarification over this topic.

Please do leave a thumbs up and an upvote if this answer really helped you :-)

gladiator answered 1 year ago

Next > < Previous

Related Solutions

A 3000 bp region of the human genome encodes two genes. One of the genes encodes...

9. Most of the genes in the human genome code for enzymes. Why? What are the...

9. Most of the genes in the human genome code for enzymes. Why? What are the functions of enzymes?

Human FAV gene's coding region is 7440 bp long however the produced protein is 680 amino...

Human FAV gene's coding region is 7440 bp long however the produced protein is 680 amino acid long. What is the reason? Explain scientifically using NUMBERS.

What is the primary function of rRNA? : * (A) rRNA encodes the messages for genes...

What is the primary function of rRNA? : * (A) rRNA encodes the messages for genes which are then translated by ribosomes in the cytoplasm. (B) rRNA anticodons are paired with codons by ribosomes to assemble nascent peptides during translation. (C) rRNA is the nucleic acid component of ribosomes and binds RNA messages during translation. (D) rRNA encodes a gene in the nucleus of a cell prior to transcription by host polymerases.

1) Give two mechanisms by which new genes are introduced into a genome 2) in 20...

1) Give two mechanisms by which new genes are introduced into a genome 2) in 20 words or less describe a "dominant-negative" mutation 3) explain the differences between an activator and inducer

Describe what is meant by the terms ‘pan genome’ and ‘core genome.’ What sorts of genes...

Describe what is meant by the terms ‘pan genome’ and ‘core genome.’ What sorts of genes do you expect to be present in the core genome? What sorts of genes are found in the pan genome but outside the core genome? What processes of genetic exchange give rise to the great diversity of genome sequences in the various strains of a given species?

Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’...

Part A: The following sequence encodes a protein in the virus genome: 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ How many amino acids long is the protein? Part B: A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Part A. True/False

A generous estimate of how much of our genome encodes an RNA accounts for only about...

A generous estimate of how much of our genome encodes an RNA accounts for only about 1/14th of its length; what else is in our genome? At the end of class I made the calculation that showed only 250,000,000 base pairs of our genomes 3,400,000,000 bp. And I briefly introduced a few things we have discovered in what used to be considered 'junk' DNA. Before class on Tuesday, I'd like you to discover more about what research is discovering in...

what best describes the human genome?

Most mitochondrial genes are encoded by the nuclear genome True False

Subjects