Question

In: Math

6. For each of the scenarios below, identify the sampling blunder, speculate about the influence of...

6. For each of the scenarios below, identify the sampling blunder, speculate about the influence of the bias, and then make a recommendation for ridding the study of the biasing influence. a. A researcher wanted to know how people in the local community felt about the use of high-stakes testing in the public schools. The researcher spent the afternoon at Wal-Mart and randomly approached 100 shoppers to ask their opinion (they all agreed to cooperate). Random selection was accomplished with the use of a random number table (the numbers determined which shopper to target, such as the 16th to exit, then the 30th to exit, then the ninth to exit, etc.). b. A researcher wanted to know how students at a university felt about mandatory fees for all students to support a child care center for students with children. The researcher set up a table near the dormitory where many different types of students came and went. Those who stopped at the table and seemed friendly were asked to complete the questionnaire. c. To study differences in occupational aspirations between Catholic high school students and public high school students, a researcher randomly sampled (using school rosters and a random number table) 200 students from the largest Catholic high school and the largest public high school. d. To learn more about teachers' feelings about their personal safety while at school, a questionnaire was printed in a nationwide subscription journal of interest to many teachers. Teachers were asked to complete the questionnaire and mail it (postage paid) to the journal headquarters for tabulation. e. To study the factors that lead teachers in general to quit the profession, a group of teachers threatening to quit was extensively interviewed. The researcher obtained the group after placing an announcement about the study on the teachers' bulletin board at a large elementary school.

Solutions

Expert Solution

Scenario A -

Sampling the shoppers at a certain period of time (in this case, afternoon) can not be considered the representative sample for the population.

Speculation - The conclusion from the study can bend in oppose of high-stakes because of possibility that during afternoon mostly generation x or baby boomers visit the shopping center and they could tend to be more lenient towards students as compared to overall sample and thereby biasing the results toward opposing high-stakes testing.

Recommendation - Interviewing people at random time periods can mitigate the bias

For Scenario B-

Researcher wants to understand all of university's students feeling about mandatory fees but instead he is sampling students who are seemingly friendly.

Speculation- This can lead in biasing the conclusion towards feeling good about mandatory fees for all students to support a child care center for students with children. Because seemingly friendly students can be more likely to feel good about such a cause as compared to other students.

Recommendation- Setting up a table where all (not many) students can be seen and asking students at random about their feelings.

For Scenario C-

Researcher wants to understand differences in occupational aspirations between Catholic high school students and public high school students, so he should take a random sample from two groups separately which also mean he shouldn't choose students from one particular school.

Speculation - The occupational aspirations of largest catholic school students can be higher than the sample aspirations of catholic school whereas that of largest public school students can be lower than the sample aspirations of public school students.

This can result in comparison of the one end of the extreme of one population with the other end of the extreme of other population which instead should be comparison of the population's central tendency.

Recommendation- Sample random students from schools selected at random for both groups.

For Scenario D-

Teachers reading journals regularly can be the ones who are happier in their profession as compared to teacher's happiness overall.

Speculation- Sampling results only based on view of teachers who read journal regularly can be biased towards teachers feeling safe personally while at school.

Recommendation- Considering all mediums through which teachers can be contacted and then analyzing the results.

For Scenario E-

We intend to study the factors that lead teachers in general to quit the profession, but we have sampled teachers threatening to quit for interview.

Speculation- Teachers threatening to quit their job can bias the results towards certain factors such as less pay, non flexible timings etc.

Recommendation- Interviewing teachers who don't threaten to leave their job but politely want to leave their job along with teachers threatening to do so


Related Solutions

​​​​​​ Identify the kind of sampling was implemented in the following scenarios. Police at a sobriety...
​​​​​​ Identify the kind of sampling was implemented in the following scenarios. Police at a sobriety checkpoint pull over every fifth car to determine whether the driver is sober. A pollster obtains a list of all the residential addresses in a certain town and uses a computer random number generator to choose 150 of them. The pollster visits each of the 150 households and interviews all the adults in each household about their television viewing habits. Officials at a metropolitan...
Practice Concluding a Hypothesis Test For each of the scenarios below complete the following: - Identify...
Practice Concluding a Hypothesis Test For each of the scenarios below complete the following: - Identify the null and alternative hypothesis. - State if the results are statistically significant and why - Conclude the hypothesis test in context 1. We are interested in answering the question: In Richmond Kentucky, are less than 75% of stray dogs spayed/neutered? A random sample of 150 stray dogs found that 70% were spayed/neutered. The test was performed at the 10% significance level and the...
Practice Concluding a Hypothesis Test For each of the scenarios below complete the following: - Identify...
Practice Concluding a Hypothesis Test For each of the scenarios below complete the following: - Identify the null and alternative hypothesis. - State if the results are statistically significant and why - Conclude the hypothesis test in context 1. A researcher believes that if patients with arthritis go to physical therapy twice a week their pain levels will be lower than usual pain levels. Patients with arthritis usually rate their pain a 3.5 on an 8-point scale. The test was...
For each of the scenarios described below identify 2 control procedures that could have prevented the...
For each of the scenarios described below identify 2 control procedures that could have prevented the problem and explain why each of the controls would have helped. a) you manage a sales firm, and you give laptops to all salespeople. salespeople can input orders and submit them electronically while on the road. you have had a few problems with this system. In one instance an order for 5 pcs was input b the salesperson as 500 pcs. in another case,...
2. (6 pts) Speculate on the effects of each of the following mutations on the translation...
2. (6 pts) Speculate on the effects of each of the following mutations on the translation of the following mRNA. Specifically indicate whether any product would be made, and if so, if it would be altered in any way.  (GpppG is the 5’ cap) 5’GpppGUAACAUGGUCGGACCAUGAC(A)2003’ Mutation that removes the editing pocket from isoleucine-tRNA synthetase. Mutation that prevents GTP hydrolysis of eEF1-a. Mutation that prevents binding of GTP by eEF2.
For each of the following research scenarios, give the appropriate sampling distribution (i.e., test statistic) and...
For each of the following research scenarios, give the appropriate sampling distribution (i.e., test statistic) and indicate the appropriate statistical procedure to test the null hypothesis, and state the most appropriate null and alternate hypotheses A research group believes that changes in the annual extent of sea ice cover in the Beaufort Sea affects the mercury concentration in ringed seals that the people of Ulukhaktok (formerly known as Holman) NWT rely on as an important food source. They measured mercury...
For each of the following research scenarios, give the appropriate sampling distribution (i.e., test statistic) and...
For each of the following research scenarios, give the appropriate sampling distribution (i.e., test statistic) and indicate the appropriate statistical procedure to test the null hypothesis, and state the most appropriate null and alternate hypotheses House sales price is known to be highly influenced by location. An urban geographer believes that suburban houses within walking distance (<1.5 km) of transit hubs such as rail or subway stations will be more attractive and thus more expensive than similar sized houses more...
For each of the five scenarios identify the following Principal diagnosis Identify the guideline followed for...
For each of the five scenarios identify the following Principal diagnosis Identify the guideline followed for the principal diagnosis selection (Look at Section II of the Guidelines lines, which one (A, B, C, etc.) would you follow?) Identify the main term of the principal diagnosis (what term would you start with to look up the diagnosis in the alphabetical index) Assign the appropriate ICD-10-CM code. Scenario 1: The patient was admitted to the hospital with right lower quadrant abdominal pain....
One of the scenarios below is a Binomial Experiment and the other is not. For each​...
One of the scenarios below is a Binomial Experiment and the other is not. For each​ scenario, state whether or not it is a Binomial Experiment. If it​ is, give the values of n and p and state all the possible values of X. If it is​ not, say why​ (which of the four conditions are not​ met?). ​(a) In the 2008 presidential​ election, 54% of the voters voted for President Obama. Suppose 5 people who voted in the 2008...
For each of the following scenarios, identify the nonverbal message being sent and indicate if the...
For each of the following scenarios, identify the nonverbal message being sent and indicate if the sender and/or receiver should handle the matter differently: While you are talking to a client, she starts drumming her fingers on her desk. You are a new employee attending your first group meeting. When a man arrives after the meeting has started, others stand up to offer him a chair. When you make a suggestion at a group meeting, a colleague rolls her eyes....
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT