Question

In: Finance

Discuss at least two (2) specific financial theories that can be utilized to improve a firm...

Discuss at least two (2) specific financial theories that can be utilized to improve a firm or institution’s efficiency or operations. This may include a Small to Medium Enterprise (SME) or a Multi-National Enterprise (MNE). Cite resources.

Solutions

Expert Solution

Financial Theories

Financial theories offers specific financial guidance to individuals. There are several categories of financial theories that can be used by SME and also MNE. Financial theories provide a wide range of direction to companies and individuals who want to excel in business.

Financial management theories
These following approaches address precise problems in the field of management and leadership and boost operations efficiently and reach organisational goals.
Business and finance have a close connection to each other. Companies are expected to make financial and investment decisions. Some of the key decisions in business environment focus on:
• Borrowing
• Labor
• Dividend

Therefore the individuals charged with managing institutions need to have a strong affiliation to financial theories by which they can be able to make decisions that will increase:
• Revenues
• Grow investment
• Promote healthy relationships with stakeholders

When theories are used in businesses the functions become easier since the finance managers comprehend how they can approach matters such as-
• Acquisitions
• Expenditure
• Sales efficiency

Examples of financial theories

Investment Theory
Investment theory indicates that capital investment should grow over time. It tries to explain how individuals can grow capital or calculate investment flow.
An investment flow calculation involves getting the difference between the capital at the end and start of the period. As a theory of financial management practice, this theory plays a vital role in differentiating investment and capital.

Expectation Theory
The expectation theory is the simplest interest rate approach, and it is used to manage investments. It suggests that the interest structure depends on investments pricing and maturity. This theory indicates that the two investment options are the same because the risks involved may be the same.
Expectation theory also deduces that projections of future interests rates may correspond with incoming rates attained in time. This approach helps individuals in making investment assumptions.






Related Solutions

Discuss two strategies in which health information technology could be utilized to improve healthcare quality that...
Discuss two strategies in which health information technology could be utilized to improve healthcare quality that could result in improved patient safety. (Example: E-prescribing, Pay For Performance, etc.). What have you observed in professional practice and/or does the literature state regarding these strategies?
1. Describe at least two specific actions that a company could take to improve its ROI?...
1. Describe at least two specific actions that a company could take to improve its ROI? 2. Compare and contrast a master budget and a flexible budget? -Answer has to be open-ended to discussion.
Q2 Identify two (2) pieces of firm-specific information not included in the principal financial statements that...
Q2 Identify two (2) pieces of firm-specific information not included in the principal financial statements that you think would be important to someone considering whether to invest in your company. Explain your reasons for believing that this information would be important in making an investment decision. What does this question mean or asking for? I've been given the entire annual report for Wesfarmers 2018
Identify and describe practices typical of commercial supply chains that can be utilized to improve the...
Identify and describe practices typical of commercial supply chains that can be utilized to improve the effectiveness of humanitarian supply chains. Likewise, identify and describe practices of humanitarian supply chains that can be utilized to improve commercial supply chains.
R5-1. An antibody specific for a protein of interest can be utilized in which of the...
R5-1. An antibody specific for a protein of interest can be utilized in which of the following protein separation techniques. a.     Ion-exchange chromatography b.    affinity chromatography c. western blot d.    Edman degradation e.     A and B f.      B and C
PCR can be utilized to generate a large quantity of a specific DNA fragment. The following...
PCR can be utilized to generate a large quantity of a specific DNA fragment. The following questions refer to a PCR reaction designed to amplify the DNA helix below. Region 1 Region 2 5’ GCTAGCTGTGGCTTAATATAGCCCGCAGTAGCGT 3’ b. While mixing up the PCR reaction mix, you accidentally add too little of the concentrated buffer, thus producing a lower than anticipated ion concentration. To compensate, you should (INCREASE/DECREASE/NOT ALTER) the denaturation temperature. Which of the explanations below best supports your answer? A....
Discuss the technique of filtration as a microbial control method, why it's utilized, and specific materials...
Discuss the technique of filtration as a microbial control method, why it's utilized, and specific materials that are filtered.
Discuss at least three different theories concerning the formation of states. How do these theories differ,...
Discuss at least three different theories concerning the formation of states. How do these theories differ, and how are they similar? What are some of the strengths and weaknesses of each?
Explain how hydraulic jumps can be utilized in hydraulic structures. Choose an example and be specific.
Explain how hydraulic jumps can be utilized in hydraulic structures. Choose an example and be specific.
Choose at least two (2) specific transactions and determine the types of accounting methods that would...
Choose at least two (2) specific transactions and determine the types of accounting methods that would be available for your business. Recommend the method that would minimize the tax liabilities for the company. Provide support for your rationale.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT