Question

In: Biology

R5-1. An antibody specific for a protein of interest can be utilized in which of the...

R5-1. An antibody specific for a protein of interest can be utilized in which of the following protein separation techniques.

a.     Ion-exchange chromatography

b.    affinity chromatography

c. western blot

d.    Edman degradation

e.     A and B

f.      B and C

Solutions

Expert Solution

Ans) F. B & C (affinity chromatography & western blot)

Affinity chromatography: the main principle of this technique is affinity. The natural affinities between the two compounds are utilized for the separation of molecules.

Example for the pairs of compounds that show natural affinities

Antigen and antibody, Hormone and receptor, Enzyme and substrate, Ligand and receptor

In Affinity chromatography to separate a desired protein, the antibody against the desired protein is raised which specifically recognizes protein. The antibody attached matrix packed into the column and the protein sample is passed through the column. Due to the affinity, the matrix connected antibody attaches to the desired protein and remaining proteins are eluted out. Later with the help of specific buffers, our desired protein is eluted out.

Western blot: it is also referred to as immune blot and used to separate the protein of interest from a tissue sample or homogenate mixture of the sample with the help of antibody specific to the protein of interest. In Western blot first the proteins are immobilized on a membrane and then antibody (primary) is added. The presence of protein detected by the use of the enzyme-linked secondary antibody.


Related Solutions

1. How does immunoblotting allow for a specific protein to be identified? 2. The primary antibody...
1. How does immunoblotting allow for a specific protein to be identified? 2. The primary antibody was made by injecting purified Rubisco proteins into rabbits and collecting the antibodies that the rabbit produced against this foreign protein. The secondary antibody was made in a goat. What was injected into the goat? 3. What would have happened if the membrane was not incubated in blocking buffer before the primary antibody incubation step? 4. During the transfer step, what would have happened...
PCR can be utilized to generate a large quantity of a specific DNA fragment. The following...
PCR can be utilized to generate a large quantity of a specific DNA fragment. The following questions refer to a PCR reaction designed to amplify the DNA helix below. Region 1 Region 2 5’ GCTAGCTGTGGCTTAATATAGCCCGCAGTAGCGT 3’ b. While mixing up the PCR reaction mix, you accidentally add too little of the concentrated buffer, thus producing a lower than anticipated ion concentration. To compensate, you should (INCREASE/DECREASE/NOT ALTER) the denaturation temperature. Which of the explanations below best supports your answer? A....
how to use an antibody to probe or detect a protein.
how to use an antibody to probe or detect a protein.
Discuss at least two (2) specific financial theories that can be utilized to improve a firm...
Discuss at least two (2) specific financial theories that can be utilized to improve a firm or institution’s efficiency or operations. This may include a Small to Medium Enterprise (SME) or a Multi-National Enterprise (MNE). Cite resources.
Explain how hydraulic jumps can be utilized in hydraulic structures. Choose an example and be specific.
Explain how hydraulic jumps can be utilized in hydraulic structures. Choose an example and be specific.
which antibody is an indicator of a current infection and which antibody is an indicator of...
which antibody is an indicator of a current infection and which antibody is an indicator of a past infection?
How would a monoclonal antibody to a viral protein be prepared?
How would a monoclonal antibody to a viral protein be prepared?
What makes each antibody specific to an antigen
What makes each antibody specific to an antigen
Give your recommendation about the concept of specific heat capacity and latent heat can be utilized...
Give your recommendation about the concept of specific heat capacity and latent heat can be utilized in ice- cream industry to cool the ice creams and in cooking food in the kitchen. In the latent heat formula, Q = ± mL, how can you make the significance of dual sign in the formula? How can you provide scientific justifications to prove that there are some differences in total cooking time in open vessels compared that with a closed vessel like...
Which specific type of T cells is involved in the clonal selection of antibody-producing B cells?
Which specific type of T cells is involved in the clonal selection of antibody-producing B cells?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT