Explain how hydraulic jumps can be utilized in hydraulic structures. Choose an example and be specific.

Expert Solution

Hydraulic jump- Hydraulic jump is defined as the rise of water level that takes place due to transformation of super critical flow(unstable flow) to subcritical flow(stable flow).

To understand subcritical and supercritical flow , we have to understand what is Froud number. It is defined as ratio of square root of viscous force to gravitational force.

If Froude number is less than 1, then it is subcritical and if Froude number is greater than 1, then it is supercritical flow.

Utilization- Hydraulic jump has a lot of energy which act as a energy dissipator.

Hydraulic jump also produces disturbances in the flow such as eddies formation, reverse flow, etc.

Now how hydraulic jump can be utilized to the structure which are following-

Hydraulic jump can be used to dissipate energy because it has a lot of energy which can cause damages to the structure. So it helps to save structure from damages.
Hydraulic jump can also be uses for mixing chemicals in water for purification of water.
To remove air from water hydraulic jump can play a vital role.

Example- Spillways- spillway is used to control releasing of water , when water flowing from spillway then it falls from a considerable height which cause hydraulic jump.

Ally Wells answered 9 months ago

How to choose suitable hydraulic components for a parallel hydraulic hybrid vehicle? Explain briefly for each...

How to choose suitable hydraulic components for a parallel hydraulic hybrid vehicle? Explain briefly for each components (pump, motor, accumulator and etc)

Prompt: Explain the various classification structures for an agency’s cost estimation, and give a specific example...

Prompt: Explain the various classification structures for an agency’s cost estimation, and give a specific example of each.

The probability that a specific hydraulic actuator can be successfully repaired in the field, once it...

The probability that a specific hydraulic actuator can be successfully repaired in the field, once it has failed, is estimated at 0.4. You are asked to optimize the shipment of a limited supply of spares and maintenance personnel. If 15 actuators have failed today, what is the probability that A) at least 10 are repairable? B) from 3 to 8 are repairable? C) exactly 5 are repairable?

R5-1. An antibody specific for a protein of interest can be utilized in which of the...

R5-1. An antibody specific for a protein of interest can be utilized in which of the following protein separation techniques. a. Ion-exchange chromatography b. affinity chromatography c. western blot d. Edman degradation e. A and B f. B and C

cite and explain how chi square is utilized in stat analysis by giving an example including...

cite and explain how chi square is utilized in stat analysis by giving an example including constructing a 2x2 table

PCR can be utilized to generate a large quantity of a specific DNA fragment. The following...

PCR can be utilized to generate a large quantity of a specific DNA fragment. The following questions refer to a PCR reaction designed to amplify the DNA helix below. Region 1 Region 2 5’ GCTAGCTGTGGCTTAATATAGCCCGCAGTAGCGT 3’ b. While mixing up the PCR reaction mix, you accidentally add too little of the concentrated buffer, thus producing a lower than anticipated ion concentration. To compensate, you should (INCREASE/DECREASE/NOT ALTER) the denaturation temperature. Which of the explanations below best supports your answer? A....

how can branding a product be utilized in business?

Referring to specific anatomical structures, how is vision affected by the physical structures of the eye?...

Referring to specific anatomical structures, how is vision affected by the physical structures of the eye? a) Eyeballs of a newborn are shorter (front to back) than the eyes of an adult b) In some individuals, continued growth of eyeballs front to back exceeds the average rate c) In some individuals, continued growth of eyeballs front to back is slower than the average rate d) During aging, overall melanin production tends to decline

Discuss at least two (2) specific financial theories that can be utilized to improve a firm...

Discuss at least two (2) specific financial theories that can be utilized to improve a firm or institution’s efficiency or operations. This may include a Small to Medium Enterprise (SME) or a Multi-National Enterprise (MNE). Cite resources.

Identify an example of three of the Cellular functions listed below. Describe specific structures that are...

Identify an example of three of the Cellular functions listed below. Describe specific structures that are used to carry out the process. Identify if each example happens eukaryotic, prokaryotic or both cell types. 1. Regulates transportation of materials 2. Performs chemical reactions 3. Transforms energy 4. Adapts and evolves 5. Synthesizes and secretes proteins

Question