Question

In: Biology

What are six possible reasons for a PCR not generating an amplified DNA product?

What are six possible reasons for a PCR not generating an amplified DNA product?

Solutions

Expert Solution

polymerase chain reaction is an amplification technique that generates a large supply of a particular segment of DNA.When PCR fails it leads to the generation of many non specific segments of DNA of varying sizes that appear as smear of bands on agarose gels.

somtimes mutations are unintentionally introduced in the amplicons, resulting in the heterogeneous population of PCR products.

the possible reasons for a PCR not generating a desired amplified DNA product are:

1. the optimised ampount of DNA input is necessary as the higher amount of DNA may increase the risk of non spec ific amplification while low amounts of DNA may reduce the yields.

2. amplification efficiency of the specific template amount is highly dependent upon reaction components and parameters.it also depends on the sensitivity of DNA polymerase. the selected DNA polymerase should be able to give results for controlled low level of residual DNA to minimise false signals in PCR.

3.primers used in the process should be optimally designed ie the first primer should be identical to the target sequence while second primer should be the reverse compliment ofthe target, secondly there should be no chance for hairpinning or primer dimerisation.

4. the reagents used in the PCR reaction should be checked and DNA sholud be added at the end to prevent its contamination

5. the concentration of all the reagents should be optimum as higher concentrations would disrupt the process while lesser concentration would reduce the yield.

6.the final step is to check all the machine parameters.


Related Solutions

what does the polymerase chain reaction (PCR) accomplish? 1) PCR converts RNA to DNA 2) PCR...
what does the polymerase chain reaction (PCR) accomplish? 1) PCR converts RNA to DNA 2) PCR corrects mutation in a gene 3) PCR makes many copies of DNA segment 4) PCR joins short segments of DNA to make one long segment how does the ribosome select the next amino acid to add to a growing polypeptide chain? 1) the ribosome selects the amino acid that can form hydrogen bonds with the mRNA 2) the ribosome selects a tRNA that base-pairs...
Design primers for the following target sequence which is to be amplified using PCR: CGGCTATCAGGATTGTTCTCTGGACCGTACATCGAACGGCTATCGAGGATTGTTCTCTGGACCGTACATTAAA Explain...
Design primers for the following target sequence which is to be amplified using PCR: CGGCTATCAGGATTGTTCTCTGGACCGTACATCGAACGGCTATCGAGGATTGTTCTCTGGACCGTACATTAAA Explain how you went about designing them.
As a reminder, PCR is the technique used to replicate DNA in the lab. PCR is...
As a reminder, PCR is the technique used to replicate DNA in the lab. PCR is based on the way DNA is replicated in cells. During PCR template DNA plus other ingredients are placed in a test tube and the solution goes through repeated cycles of heating and cooling. The 'ingredients' of a basic PCR reaction are: DNA template, primer, nucleotides, DNA polymerase, and any salts required for polymerase function (buffer). No ligase is required in PCR but it is...
During “cut and paste” cloning, the PCR-amplified gene is cut by restriction enzymes. How does the...
During “cut and paste” cloning, the PCR-amplified gene is cut by restriction enzymes. How does the synthesis of DNA oligonucleotide primers facilitate the ability to ‘cut’ the amplified gene?
What is the role of each of the following components of PCR? DNA lysate: Forward and...
What is the role of each of the following components of PCR? DNA lysate: Forward and reverse primer Taq Polymerase: Nucleotides (dNTPs): Magnesium
Discuss what are possible reasons for companies to compete on business functions and on product/service exp.
Discuss what are possible reasons for companies to compete on business functions and on product/service exp.
Explain how PCR (polymerase chain reaction) works. After explaining PCR, compare PCR to the DNA replication...
Explain how PCR (polymerase chain reaction) works. After explaining PCR, compare PCR to the DNA replication that occurs naturally in living cells, making sure to give at least 4 similarities and 4 differences.
describe the steps involved in PCR DNA amplification?
describe the steps involved in PCR DNA amplification?
why concentrated DNA cannot be used in PCR
why concentrated DNA cannot be used in PCR
What are the possible reasons for Malnutrition for pediatric?
What are the possible reasons for Malnutrition for pediatric?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT