Question

In: Biology

1) Define and compare the four levels of protein organization. How does the sequence of nucleotides...

1) Define and compare the four levels of protein organization. How does the sequence of nucleotides of the gene relate to the levels of protein organization?

2) Explain transcriptional control of gene expression using the expression of the lac operon in Escherichia coli

Solutions

Expert Solution

Four level of protein organisations are :

1. Primary Structure:

The linear sequence of amino acids forming the backbone of protein.

Each protein has a unique sequence of amino acids which is determined by the genes contained in DNA. The primary structure of a protein is largely responsible for its function.In case of primary structure of protein amino acids are held together by a protein covalent peptide bond or linkage.

2. Secondary structure :

The spatial arrangement of protein by twisting of the polypeptide chain.

the conformation of polypeptide chain by twisting of folding is referred to as secondary structure. The amino acids are located close to each other in their sequence. Two types of secondary structures Alpha helix and beta sheet are mainly identified.

Alpha helix:

Alpha helix is the most common spiral structure of a protein. It has a rigid arrangement of polypeptide chain.

Beta pleated sheet:

This is the second type of structure proposed by Pauling and Corey.beta pleated sheet are composed of two or more segments of fully extended peptide chains.

3. Tertiary structure :

The the three-dimensional structure of a functional protein.

it is a compact structure with hydrophobic side chains held interior while the hydrophobic groups are on the surface of the protein molecule. This type of arrangement ensure stability of the molecule.

4. Quaternary Structure :

Some of the proteins are composed of two or more polypeptide chains referred to as subunits. The spatial arrangement of the subunits is known as quaternary structure.

  • Linear nucleotide sequence in gene is directly translated into the linear primary structure of protein.So primary structure completely corresponds to the nucleotide sequence.

The folding of proteins causes the secondary and the tertiary structures which are dictated by the activity of the H bonds covalent bonds etc. between primary amino acid residues that in turn depends on neucleotide sequence.So there is indirect relationship.

2. Lac operon :

The lac lac operon consists of a regulatory gene (I), operator gene (O) and three structural gene (Z , Y, A).besides these genes there is a promoter site (P) next to the operator gene where the enzyme RNA polymerase binds. The structure genes Z ,Y and A respectively code for the enzymes beta- galactosidase , galactose permease and galactose acetylase. Beta galactosidase hydrolyses lactose to galactose and glucose while permease is responsible for the transport of lactose into the cell.

Repression of lac operon:

The regulatory gene (I) is constitutive. It is expressed at a constant rate leading to the synthesis of lac repressor. Lac repressor is a tetrameric regulatory protein which specifically binds to the operator gene (O). This prevents the binding of the enzyme RNA polymerase to the promoter site (P) thereby blocking the transcription of structural genes ( Z, Y and A). Thid is what happens in the absence of lactose in E. coli. gadi pressure molecule acts as a negative regulator of the gene expression.

Depression of lac operon:

In the presence of lactose ( inducer) in the medium , a small amouny of it can enter the E.coli cells. The repressor molecules have a high affinity for lactose. The lactose molecules bind and induce a conformational change in the repressor. the result is that the depression gets in activated and therefore cannot bind to the operator gene (O). The RNA polymerase attaches to the DNA at the promoter site and transcription precedes leading to the formation of poly cistronic mRNA ( for genes. Z ,Y and A) and finally the 3 enzymes. Thus lactose induces the synthesis of the three enzymes beta galactosidase, galactoside permease and galactoside acetylase. Lactose acts by in activating the repressor molecules in the process is known as depression of Lac operon.


Related Solutions

Describe how six of these forces hold proteins together, in each of the four different levels of protein organization
Proteins have different levels of organization, held together by different forces. Describe how six of these forces hold proteins together, in each of the four different levels of protein organization (and list the four levels of protein organization as well).
What are nucleotides? How do nucleotides contribute to genes and chromosomes? Why is the trinucleotide sequence,...
What are nucleotides? How do nucleotides contribute to genes and chromosomes? Why is the trinucleotide sequence, CAG, important in Huntington Disease?
Topic: Protein Denaturation 1) What are the various levels of organization that any protein structure may...
Topic: Protein Denaturation 1) What are the various levels of organization that any protein structure may have that gives it its 3D shape? Which of these changes during denaturation? 2) For each change made to a protein solution, how might it affect the interactions that are involved in a protein's shape? 3) What is the difference between precipitation of a protein and its denaturation? How might you tell the difference?
How do the four levels of protein structure affect the shape of enzymes and why is...
How do the four levels of protein structure affect the shape of enzymes and why is this important for enzyme function? Explain the "lock and key" model of enzyme function using the terms substrate, active site, and product.
1. Define and explain the four levels of ethical analysis. 2. Describe the four stages of...
1. Define and explain the four levels of ethical analysis. 2. Describe the four stages of the ethical decision-making model. 3. Explain the deontological and teleological orientations, then give an example showing how they could lead to solving the same problem in different ways. 4. Explain the test of publicity and the describe it's value.
List 3 types of mutations in DNA sequence. How does each affect the resulting protein?
List 3 types of mutations in DNA sequence. How does each affect the resulting protein?
Compare to this DNA sequence: 1. Forward sequence: GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAG
Compare to this DNA sequence: 1. Forward sequence: GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTACCACACATCAACTGCAACTCCAAAGCCACCTCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGAAAACCCTTGACCAACCATCCTCCAGGGCCGAGGGTAATTTCTTTTGGTTTCATTCTAAAGGCACCATTGTGCGACTTTCTATTTGAACTCAAGGGCAGTTTCTTTATTCCTCTCCCTTTACTCTCGCATCCTTAAAGGAAAAGGAGGTTTCGAATTCCCCCCTGTCTAATTGTTAGAGCACACATAGGCGATCGTTCTATAACTCAGCACAAACCGGGGGGAAAAACATTTCATAGGGGCACTAAGTCTCGGATTCCCCATCTTCCCCCGGGGGCTGGGCGGGTAGCCCCTTGAAAACACTAGACCCTTCGGTGGTAAAAATTGCCTACAACCGAATTAAAAAATGAGAGCCGTTTTTCCTGGC Reverse sequence: ATTTTGAGGGGGCTTCTTGGGGGGCGAGTAGGATTGACTCGTGATGTGCTATGTACGGTAATGGCTTTATGTACTATGTACTGTTAAGGGTGGGTAGGTTTGTTGGTATCCTAGTGGGTGAGAGGTGGCTTTGGAGTTGCAGTTGATGTGTGGTAGTTGAGGGTTGATTGCTGTACTTGCTTGTAAGCATGGGGAGGGGGGTTTTGATGTTGGATTGGGTTTTTTATGTACTACAGGTGGTTAAGTATTTTATGGTACCGTGCAATTATTTCATGGGTGGCTGGGCAGTATTGTACGGAGATACCATAGCGGGTTGGTTGGATGGGGTAAAGTCATTAATTTGGGGTGGGTACCCCAAATCTGCTTCCCCCATGAAAAGAAACAGAGAATAAGTTTTAATTTTGGTTTCTTTAGCTTTGGGGTGCTTAATGGGGGGGAGGTTAAAAAACCCCCCCGCCGTTTCCCGGGGGGGGGGGGGGGGGCAACCTTCCCCGGGCCCGGGGGGAAAACTAACCCGTATGGACAGTCTTCCAATCACGTCAAAGTTTAGGTCTTTTTATATTACTTCAATGGGGCTGGGGGACGTTCGGGAAAACGGGTGACCCATTGGGGGGTTAATCACCTTGGGGGATAGTCCGGTGGGGGAGCTGGCCCAAGTGCCCAATATCAACGTGGTGACGGGGGGGTGGGGGGGGGGCGGTGGGGTCTCGAAA
List in the correct order and define in a sentence the different levels of ecological organization...
List in the correct order and define in a sentence the different levels of ecological organization (individual, population, species, community, ecosystem, biome, biosphere). Define the terms planktonic, nektonic, pelagic and benthic organisms. POPULATION ECOLOGY Define the term population in a sentence. In a paragraph, explain what is meant by a population’s biotic potential and the environmental resistance that limits this potential.
Define and describe the six levels of organization of the body and explain the eleven major...
Define and describe the six levels of organization of the body and explain the eleven major organs systems in the body.Define and describe the six levels of organization of the body and explain the eleven major organ systems in the body?
Discuss the concept of structure-function as it pertains to all 4 levels of protein organization. Nuance...
Discuss the concept of structure-function as it pertains to all 4 levels of protein organization. Nuance concerning structure equaling function at chemical and biological levels is welcome
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT