Question

In: Psychology

Identify one critical infrastructure or key resource CI/KR with which you are most likely to interact...

Identify one critical infrastructure or key resource CI/KR with which you are most likely to interact in a typical day. Choose the one with which you are least likely to interact. Explain why you considered them to be critical in your daily life.

Solutions

Expert Solution

  • Critical infrastructure and key resources (CIKR) is the totality of natural and man-made resources upon which a nation depends on for functioning, along with the systems for their processing, delivery and protection.
  • Critical infrastructure includes transport, energy, IT, communications, agricultural, food and water systems, as well as other sectors.
  • The power resource is the major critical infrastructure that we use everyday.Its there in our homes and workplaces. All our home appliances from television to air conditioners work on power.And this is the most used resource on an everyday basis without which our lives stop.
  • Even the transportation we use on an everyday basis to travel anywhere is another major used facility.It definitely makes communicating easy and faster.
  • Chemicals probably is the one which least interacted with by common people like us.The Chemical Sector is an integral component of the U.S. economy that manufactures, stores, uses, and transports potentially dangerous chemicals upon which a wide range of other critical infrastructure sectors rely. Securing these chemicals against growing and evolving threats requires vigilance from both the private and public sector.

Related Solutions

Which Relative Risk (RR) and confidence interval (CI) is most likely to be a causal relationship?...
Which Relative Risk (RR) and confidence interval (CI) is most likely to be a causal relationship? A) RR= 3.0 (95% CI 1.9-7.9) B) RR= 3.0 (95% CI 0.3-12.2) C) RR= 1.0 (95% CI 0.3-12.2) D) RR= 1.0 (95% CI 0.3-4.3)
Which key trait of a successful IT Auditor you feel is the most critical to information...
Which key trait of a successful IT Auditor you feel is the most critical to information security work, explain? Which selling point for recruiting IT professionals into IT Audit most appeals to your career goals, why?
Which of the following approaches is most likely to identify a gene?
Which of the following approaches is most likely to identify a gene?Identifying sequences that are not different between two species.Identifying regions of that genome that are not transcribed.Identifying sequences that can be deleted without any phenotypic effect.Identifying sequences that do not have open reading frames.   
Which of the following processes is most likely to play a critical role in generating antibodies...
Which of the following processes is most likely to play a critical role in generating antibodies that effectively combat fungal infections? Group of answer choices: A.Fc receptors B.Allelic exclusion C.T cell help D.Apoptosis E.Use of the kappa (k) light chain
Identify/highlight all possible palindromic sequences. Which one of these two examples is most likely to form...
Identify/highlight all possible palindromic sequences. Which one of these two examples is most likely to form a hair loop - highlight the hair loop sequence? Example 1: 5' - GCAACTGGATAGCCCTAGAAGGACTAGGGCTTTTCCAAGTCAA - 3' Example 2: 5' - TATTTGCATTCCCTGCAGGGAATCGTTAAGGAGGGCAGTCTTAA - 3'
1. What kind of cell is most likely to interact with a class I MHC protein...
1. What kind of cell is most likely to interact with a class I MHC protein on a cell surface? 2. The antibody-combining site binds to a part of the antigen that is complementary to the combining site. What is this portion of the antigen called? 3. Which T cell is most likely to be stimulated by the appearance of exogenous antigens presented by an antigen-presenting cell? 4. What properties of fibronectin and other similar molecules of the ECM allow...
A. Discuss which specific sector of crucial infrastructure you think is least critical and why (example:...
A. Discuss which specific sector of crucial infrastructure you think is least critical and why (example: chemical, commercial, communication, dams, emergency services, energy, food & agriculture, healthcare, IT, nuclear reactors, transportation, waster & waste?) B. Discuss what sectors you think to be present within your neighborhood & provide examples.
Thinking of the Middle East, identify at least one item that is most likely produced using...
Thinking of the Middle East, identify at least one item that is most likely produced using job order costing ( i have choosen refined petroleum with pre defined attributes), and one item that is most likely produced using process costing (crude oil). Explain why you think each one would be produced under the system identified.
Which one of the following items is most likely to be reported as goodwill? A. Skilled...
Which one of the following items is most likely to be reported as goodwill? A. Skilled workforce B. In-process research and development C. Brand names D. Developed technology
Which one of the following time series is most likely to be stationary? Select one: Consumer...
Which one of the following time series is most likely to be stationary? Select one: Consumer price index Financial asset returns Life expectancy Nominal gross domestic product Provide a detailed explanation on why the selected option is correct.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT