Question
In: Civil Engineering
(b) Answer the following in relation to flow through orifices. (i) Explain why the coefficient of...
(b) Answer the following in relation to flow through orifices.
(i) Explain why the coefficient of contraction is included in the discharge equation for flow through a small orifice. [3 marks]
(ii) If a small orifice meter with a diameter of 0.016 m discharges flow at a rate of 6 x 10-4 m3 /s under a head of 1.6 m, what is the value of the discharge coefficient? [2 marks]
(iii) Explain the hydraulic difference between a small orifice and a large orifice.
Solutions
Expert Solution
if
you have any doubts please ask me...... please upvote me......
tq..... have a good day ?
Ally Wells answered 9 months agoRelated Solutions
(b) Answer the following in relation to flow through orifices. (i) Explain why the coefficient of...
(b) Answer the following in relation to flow through orifices.
(i) Explain why the coefficient of contraction is included in the
discharge equation for flow through a small orifice. [3 marks] (ii)
If a small orifice meter with a diameter of 0.016 m discharges flow
at a rate of 6 x 10-4 m3 /s under a head of 1.6 m, what is the
value of the discharge coefficient? [2 marks] (iii) Explain the
hydraulic difference between a small orifice and...
(b) Answer the following in relation to flow through orifices. (i) Explain why the coefficient of...
(b) Answer the following in relation to flow through orifices.
(i) Explain why the coefficient of contraction is included in the
discharge equation for flow through a small orifice. [3 marks] (ii)
If a small orifice meter with a diameter of 0.016 m discharges flow
at a rate of 6 x 10-4 m3 /s under a head of 1.6 m, what is the
value of the discharge coefficient? [2 marks] (iii) Explain the
hydraulic difference between a small orifice and...
For each relation below, determine the following.(i) Is it a function? If not, explain why not...
For each relation below, determine the following.(i) Is it a
function? If not, explain why not and stop. Otherwise, answer part
(ii).(ii) What are its domain and image?
(a){(x, y) :x, y∈Z, y- 2x}.
(b){(x, y) :x, y∈Z, xy- 0}.
(c){(x, y) :x, y∈Z, y-x2}.
(d){(x, y) :x, y∈Z, x|y}.
(e){(x, y) :x, y∈Z, x+y= 0}.
(f){(x, y) :x, y∈R, x2+y2= 1}.
a) outline the flow of filtrate through the nephron. b) outline the flow of blood through...
a)
outline the flow of filtrate through the nephron.
b) outline the flow of blood through the nephron.
c) describe the properties of the ultrafiltrate of
plasma
Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse...
Please explain why B is the correct answer, I know on the
5'---->3' it goes reverse
and 3'-->5' it goes forward.......I got lost after this.
Please explain. Will give a thumbs up.
-----
Which of the following sets of primers could you use to amplify
the target DNA sequence below, which is part of the last
protein-coding exon of the gene involved in cystic fibrosis?
5’- ggctaagatctgaattttccgag … ttgggcaataatgtagcgcctt - 3’
3’- ccgattctagacttaaaaggctc … aacccgttattacatcgcggaa – 5’
a) 5’ GGAAAATTCAGATCTTAG...
What is the relation between stoichiometric coefficient with molar ratios and weight ratios respectively?I WANT A...
What is the relation between stoichiometric coefficient with
molar ratios and weight ratios respectively?I WANT A VERY DETAILED
ANSWER.
PLEASE explain why each answer of the following questions is correct, I need to understand it...
PLEASE explain why each answer of the following questions is
correct, I need to understand it .
1)Economy is at its long run equilibrium. Assuming all else
equal, stock market collapses and consumer sentiment level
deteriorates. Which of the following is incorrect?
A. In short run, output level decreases and price level
decreases.
B. In long run, output level is back to its long run output
level.
C. In short run, short run aggregate supply decrease.
D. In long run,...
the cash flow cycle______. a. describes the flow of cash through a company. b. illustrates that...
the cash flow cycle______.
a. describes the flow of cash through a company.
b. illustrates that profits and cash flows are the same.
c. reminds a financial manager that profits are important.
d. focuses on financing activities only.
Answer all questions. Explain what each of the following is in relation to thermocouples: (a) extension...
Answer all questions. Explain what each of the following is in
relation to thermocouples: (a) extension leads, (b) compensating
leads, (c) law of intermediate metals, (d) law of intermediate
temperature.
In relation to Pregnancy kit, answer the following: A- Explain how pregnancy kit is considered as...
In relation to Pregnancy kit, answer the
following:
A- Explain how pregnancy kit is considered as a “biosensor”
technology? (1%)
B- What is the biological sample required for test: blood
serum, blood plasma, saliva, urine? (1%)
C- What is the name and the nature (protein, carbohydrate,
nucleic acid?) of molecule that this pregnancy kit is detecting?
(1%)
ADVERTISEMENT
ADVERTISEMENT
Latest Questions
- Tidewater Company uses the product cost concept of applying the cost-plus approach to product pricing. The...
- Create 5 short-term plan of technology projects that you can perform outside of an I.T. department...
- Derek plans to retire on his 65th birthday. However, he plans to work part-time until he...
- Toady and Froggy were running a vegan cafe together. The business was having financial difficulties.Betelguese, who...
- 1. The following questions concern Jesse Gelsinger who suffered from partial OTC. a. In the...
- Pittman Company is a small but growing manufacturer of telecommunications equipment. The company has no sales...
- TzeMay was one of the first women engineering students at ABC University. She graduated in 1995...
ADVERTISEMENT